---
title: "Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Product information and disease description"
description: "Formulary evidence on Hibsago (bepirovirsen, GSK3228836) in Chronic hepatitis B virus infection in adults without cirrhosis: Product information and disease description. Covers Product description and Place of product in therapy. 399 evidence topics quoted from 139 sources."
canonical: "https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/product-information-and-disease-description"
published: "2026-10-21T22:39:04-04:00"
modified: "2026-10-22T19:07:03-04:00"
---
# Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Product information and disease description
## 2 Product Information and Disease Description
### 2.1 Product Description
#### 2.1.1 Phase of Product Development
##### Regulatory status: Approved; NDA submitted in the first quarter of 2026 and approved October 2026
> “In Q1, the US FDA accepted for priority review a New Drug Application (NDA) for bepirovirsen and set 26 October 2026 as the decision goal date.”
> “lower spend on bepirovirsen which was filed in the quarter”
Source: [GSK Q1 2026 results (2026)](https://www.gsk.com/media/hpgfxwxv/q1-2026-results-announcement.pdf)
> “Growth was partly offset by lower spend on bepirovirsen which was filed in Q1 2026.”
Source: [GSK Q2 2026 results (2026)](https://www.gsk.com/media/jayh41pz/q2-2026-results-announcement.pdf)
| Field | Quoted record |
| --- | --- |
| Drug name | “Hibsago” |
| Active ingredient | “bepirovirsen” |
| Approval date | “10/20/2026” |
Source: [FDA Novel Drug Approvals for 2026 (2026)](https://www.fda.gov/drugs/novel-drug-approvals-fda/novel-drug-approvals-2026)
##### Launch: Anticipated before the end of 2026
> “Hibsago should be made available to U.S. patients before the end of the year, a GSK spokesperson told Fierce”
Source: [Fierce Pharma (2026)](https://www.fiercepharma.com/pharma/gsk-brings-promise-functional-cure-hepatitis-b-finish-line-fda-nod-hibsago)
> “GSK anticipates the first regulatory decisions in Q3 2026 and launch preparations are underway.”
Source: [GSK press release, B-Well results (2026)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-achieves-unprecedented-functional-cure-rates-with-potential-to-redefine-treatment-for-chronic-hepatitis-b/)
##### FDA approval on 20 October 2026
> “The U.S. Food and Drug Administration today approved Hibsago (bepirovirsen) injection, in combination with existing antiviral therapy, to treat chronic hepatitis B virus (HBV) infection in certain adults without cirrhosis.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
> “Initial U.S. Approval: 2026”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
##### Expedited programs named at approval
> “The FDA granted Hibsago Fast Track and Breakthrough Therapy designations as well as Priority Review.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
> “The approval was granted under FDA priority review and Breakthrough Therapy Designation, recognising significant improvement of bepirovirsen and nucleos(t)ide analogue therapy over existing standard of care.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
##### Evidence supporting approval
> “Researchers studied Hibsago in two clinical trials that compared it with a placebo, an inactive treatment.”
> “Across the two trials, 24% of patients who received Hibsago met the requirements to stop their existing medicine, compared with none who received placebo.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
> “The approval was supported by results from the B-WELL phase III trials showing functional cure rates of 19% in adults with ≤3000 IU/ml HBsAg, compared to current standard of care alone, which typically achieves less than 1% functional cure rate after one year of treatment.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
##### Priority review and PDUFA goal date, April 2026
> “GSK plc (LSE/NYSE: GSK) today announced that the US Food and Drug Administration (FDA) has accepted for priority review a New Drug Application (NDA) for bepirovirsen, an investigational antisense oligonucleotide (ASO), for the treatment of adults with chronic hepatitis B (CHB).”
> “The FDA has assigned 26 October 2026 as the Prescription Drug User Fee Act (PDUFA) goal date.”
Source: [GSK press release, FDA priority review (2026)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-accepted-for-priority-review-and-granted-breakthrough-therapy-designation-by-the-us-fda/)
> “Regulatory review is ongoing in the US with a decision expected from the FDA by 26 October 2026.”
Source: [GSK Q2 2026 results (2026)](https://www.gsk.com/media/jayh41pz/q2-2026-results-announcement.pdf)
##### Breakthrough therapy designation, first quarter of 2026
> “Bepirovirsen has also received Breakthrough Therapy Designation (BTD), which is reserved for investigational medicines where preliminary clinical evidence indicates the potential for substantial improvement over available therapies.”
> “The BTD for bepirovirsen builds on the Fast Track Designation also provided by the US FDA in February 2024.”
Source: [GSK press release, FDA priority review (2026)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-accepted-for-priority-review-and-granted-breakthrough-therapy-designation-by-the-us-fda/)
> “In Q1, bepirovirsen also received FDA Breakthrough Therapy Designation which is reserved for investigational medicines where preliminary clinical evidence indicates the potential for substantial improvement over available therapies.”
Source: [GSK Q1 2026 results (2026)](https://www.gsk.com/media/hpgfxwxv/q1-2026-results-announcement.pdf)
##### Fast track designation, February 2024
> “GSK plc (LSE/NYSE: GSK) announced today that the US Food and Drug Administration (FDA) has granted Fast Track designation for bepirovirsen, an investigational antisense oligonucleotide (ASO) for the treatment of chronic hepatitis B (CHB).”
> “Data from the phase IIb trials B-Clear and B-Sure, which evaluated the efficacy, safety and durability of response of bepirovirsen in people with CHB, were submitted in support of the application.”
Source: [GSK press release, Fast Track designation (2024)](https://www.gsk.com/en-gb/media/press-releases/gsk-receives-us-fda-fast-track-designation-for-bepirovirsen-in-chronic-hepatitis-b/)
##### Phase 3 B-Well trials: initiation in February 2023
> “Ionis Pharmaceuticals, Inc. (Nasdaq: IONS) today announced that GSK has initiated two randomized, double-blind, placebo-controlled Phase 3 studies evaluating the safety and efficacy of bepirovirsen (formerly IONIS-HBVRx), an investigational antisense medicine for the treatment of patients with chronic hepatitis B infection (CHB).”
> “Ionis earned a $15 million milestone payment from GSK associated with the progression of bepirovirsen into the Phase 3 clinical studies.”
Source: [Ionis press release, phase 3 start (2023)](https://ir.ionis.com/node/29351)
##### Phase 3 B-Well trials: topline results in January 2026
> “Primary endpoint met in both trials”
> “Global regulatory filings planned from Q1 2026”
Source: [GSK press release, B-Well topline (2026)](https://www.gsk.com/en-gb/media/press-releases/gsk-announces-positive-results-from-b-well-1-and-b-well-2-phase-iii-trials-for-bepirovirsen-a-potential-first-in-class-treatment-for-chronic-hepatitis-b/)
##### Japan: application accepted in February 2026
> “First regulatory filing globally, with SENKU designation enabling expedited review”
> “GSK plc (LSE/NYSE: GSK) today announced that Japan’s Ministry of Health, Labour and Welfare (MHLW) has accepted for review a new drug application (NDA) for bepirovirsen, an investigational antisense oligonucleotide (ASO), for the treatment of adults with chronic hepatitis B (CHB).”
Source: [GSK press release, Japan acceptance (2026)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-accepted-for-regulatory-review-in-japan/)
##### Japan: SENKU designation, August 2024
> “GSK plc (LSE/NYSE: GSK) today announced that the Japanese Ministry of Health, Labour and Welfare (MHLW) has granted SENKU (formerly known as SAKIGAKE) designation for bepirovirsen, an investigational antisense oligonucleotide (ASO) for the treatment of chronic hepatitis B (CHB).”
> “The goal of SENKU designation is to increase early patient access to innovative medicines through an expedited review process to treat serious conditions and fill an unmet medical need.”
Source: [GSK press release, SENKU designation (2024)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-granted-senku-designation-in-japan-for-chronic-hepatitis-b/)
##### Japan: approval on 24 August 2026
> “First global approval for Hibsago”
> “This is the first global approval for bepirovirsen, and the first and only functional cure treatment for CHB approved in Japan.”
> “This approval was accelerated by SENKU designation, granted to innovative medicines with potential to address high unmet medical need.”
Source: [GSK press release, Hibsago Japan approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-japan-as-first-and-only-functional-cure-for-chronic-hepatitis-b/)
##### European Union: marketing authorisation application accepted in March 2026
> “GSK plc (LSE/NYSE: GSK) today announced that the European Medicines Agency (EMA) has accepted for review the marketing authorisation application (MAA) for the use of bepirovirsen, an investigational antisense oligonucleotide (ASO), in the treatment of adults with chronic hepatitis B (CHB).”
Source: [GSK press release, EMA acceptance (2026)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-accepted-for-review-by-the-european-medicines-agency-as-a-potential-first-in-class-treatment-for-chronic-hepatitis-b/)
##### China: application accepted in March 2026
> “GSK plc (LSE/NYSE: GSK) today announced that the China National Medical Products Administration (NMPA) has accepted for review a new drug application (NDA) for bepirovirsen, an investigational antisense oligonucleotide (ASO), for the treatment of adults with chronic hepatitis B (CHB).”
Source: [GSK press release, China acceptance (2026)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-accepted-for-regulatory-review-in-china-as-a-potential-first-in-class-functional-cure-for-chronic-hepatitis-b/)
##### China: breakthrough therapy designation in August 2021 and priority review in April 2026
> “Bepirovirsen was granted Breakthrough Therapy designation in China in August 2021 and accepted for Priority Review in April 2026.”
Source: [GSK press release, SBP Group collaboration (2026)](https://www.gsk.com/en-gb/media/press-releases/gsk-enters-exclusive-collaboration-with-sbp-group-a-market-leader-in-hepatology-in-china-to-accelerate-bepirovirsen-at-launch/)
##### Anticipated regulatory decisions outside the United States
> “Reviews are also underway in Japan, China and the EU with further submissions to take place throughout 2026.”
Source: [GSK Q2 2026 results (2026)](https://www.gsk.com/media/jayh41pz/q2-2026-results-announcement.pdf)
| Anticipated pipeline milestone | Event | Timing |
| --- | --- | --- |
| United States and Japan | “Regulatory decision (US, JP)” | “H2 2026” |
| European Union and China | “Regulatory decision (EU, CN)” | “H1 2027” |
Source: [GSK Q2 2026 results (2026)](https://www.gsk.com/media/jayh41pz/q2-2026-results-announcement.pdf)
> “GSK continues to advance regulatory submissions for bepirovirsen across multiple geographies with key regulatory decisions anticipated in the coming months.”
> “Bepirovirsen is approved in Japan and the US.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
##### Licensing from Ionis Pharmaceuticals, August 2019
> “Ionis Pharmaceuticals, Inc. (Nasdaq: IONS), the leader in RNA-targeted therapeutics, announced today that GSK exercised its option to license Ionis' antisense medicines for people with chronic hepatitis B virus (CHB) infection following positive Phase 2 results.”
> “As a part of the licensing agreement, Ionis is eligible to receive license fees and milestone payments up to $262 million, including a $25 million license fee.”
> “GSK is now responsible for all development, regulatory and commercialization activities and costs.”
Source: [Ionis press release, GSK license (2019)](https://ir.ionis.com/node/25196)
> “GSK licensed bepirovirsen from Ionis in 2019 under a collaborative development and licensing agreement.”
Source: [Ionis press release, Hibsago US approval (2026)](https://ir.ionis.com/news-releases/news-release-details/ionis-partner-gsk-announces-hibsago-bepirovirsen-approved-us)
#### 2.1.2 Product Information
##### 2.1.2.1 Generic, Brand Name and Therapeutic Class of Product
###### Generic and brand name
> “HIBSAGO (bepirovirsen) injection, for subcutaneous use”
> “Active ingredient: bepirovirsen sodium”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “The drug will now carry the commercial moniker Hibsago”
Source: [Fierce Pharma (2026)](https://www.fiercepharma.com/pharma/gsk-brings-promise-functional-cure-hepatitis-b-finish-line-fda-nod-hibsago)
###### Manufacturer: GSK
> “The approval was granted to GSK plc.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
> “GSK plc (LSE/NYSE: GSK) today announced that the US Food and Drug Administration (FDA) has approved Hibsago (bepirovirsen) for the treatment of chronic hepatitis B (CHB) virus infection”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
> “Trademarks are owned by or licensed to the GSK group of companies.”
> “Manufactured for”
> “GlaxoSmithKline”
> “Durham, NC 27701”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Developer: Ionis Pharmaceuticals
> “Bepirovirsen (previously known as ‘ISIS 505358 or IONIS-HBVRX’) was discovered by and jointly developed with Ionis Pharmaceuticals.”
> “Bepirovirsen is one of the ASO HBV programme assets in-licensed by GSK from Ionis Pharmaceuticals in August 2019.”
Source: [GSK press release, Fast Track designation (2024)](https://www.gsk.com/en-gb/media/press-releases/gsk-receives-us-fda-fast-track-designation-for-bepirovirsen-in-chronic-hepatitis-b/)
> “GSK licensed bepirovirsen from Ionis and collaborated with them on its development.”
Source: [Ionis press release, Hibsago US approval (2026)](https://ir.ionis.com/news-releases/news-release-details/ionis-partner-gsk-announces-hibsago-bepirovirsen-approved-us)
###### Development codes and former names
> “Bepirovirsen (formerly known as IONIS-HBVRx), also known as GSK3228836, is an investigational antisense medicine designed to reduce the production of viral proteins associated with hepatitis B virus (HBV) infection and replication”
Source: [Ionis press release, phase 3 start (2023)](https://ir.ionis.com/node/29351)
###### Therapeutic class: first antisense oligonucleotide approved for chronic hepatitis B
> “Hibsago is the first FDA-approved antisense oligonucleotide to treat chronic hepatitis B.”
> “Hibsago works by targeting the genetic instructions the virus uses to make copies of itself and viral proteins, helping reduce the amount of virus and hepatitis B surface antigen in the body.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
###### Therapeutic class: company descriptions at approval
> “Bepirovirsen is a first in class antisense oligonucleotide (ASO) and offers unprecedented functional cure rates compared to current standard of care.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
> “Bepirovirsen is a non-GalNAc-conjugated antisense oligonucleotide (ASO) designed to recognize and inhibit the production of the genetic components (i.e., RNA) of the hepatitis B virus that can lead to chronic disease, potentially allowing a person’s immune system to regain control.”
Source: [Ionis press release, Hibsago US approval (2026)](https://ir.ionis.com/news-releases/news-release-details/ionis-partner-gsk-announces-hibsago-bepirovirsen-approved-us)
###### Chemical class: 2′-O-(2-methoxyethyl) gapmer antisense oligonucleotide
> “Bepirovirsen is a synthetic, single-stranded, chimeric antisense oligonucleotide (ASO) with a gapmer architecture consisting of five 2′-O-(2-methoxyethyl) (2′-MOE)-modified ribonucleotide wings flanking a central 10-deoxynucleotide gap with phosphorothioate linkages throughout.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Chemical description: salt form, molecular formula, and molecular weight
> “The molecular formula of bepirovirsen sodium is C230H290N88Na19O115P19S19 and its molecular weight is 7761.9.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
| Field | Quoted record |
| --- | --- |
| Name | “Bepirovirsen sodium (JAN/USAN)” |
| Trade name | “Hibsago (TN)” |
| CAS number | “2563929-84-8” |
Source: [KEGG DRUG D12615](https://www.kegg.jp/entry/D12615)
##### 2.1.2.2 Dosage Forms and Strengths
###### Dosage form and strength
> “Injection: 150 mg/mL of bepirovirsen as a clear, colorless to yellow sterile solution with no visible particulates in a single-dose prefilled glass syringe within a safety syringe device.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Package and national drug code
> “HIBSAGO injection is supplied as 150 mg/mL, single-dose, prefilled glass syringe with attached 27-gauge, 0.5 inch (12.7 mm) needle with a needle guard in cartons of 2 (NDC 0173-0941-39).”
> “Each single-dose prefilled syringe delivers 150 mg of bepirovirsen in 1 mL of solution.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Syringes per dose
> “For a 300 mg dose, administer 2 x 150 mg pre-filled syringes, inject one right after the other.”
> “For a 150 mg dose administer 1 x 150 mg pre-filled syringe injection.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Solution, excipients, and latex
> “HIBSAGO injection for subcutaneous use is a sterile, preservative-free, clear, colorless to yellow solution with no visible particulates.”
> “Each 1 mL delivers 150 mg bepirovirsen, equivalent to 159 mg of bepirovirsen sodium, in 1 mL water for injection and may contain hydrochloric acid or sodium hydroxide to adjust to pH 8.”
> “The syringes are not made with natural rubber latex.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Storage before and after dispensing
> “Prior to Dispensing: Store in a refrigerator at 36°F to 46°F (2°C to 8°C). Do not freeze. Store in the original carton to protect from light. Do not shake.”
> “Following Dispensing: Store HIBSAGO at room temperature up to 86°F (30°C) for 12 weeks. Do not freeze.”
> “Discard if the expiry date has passed, or it has been 12 weeks since carton was received, whichever comes first.”
> “HIBSAGO injection must be administered within 6 hours once removed from the carton. Discard if not administered within 6 hours.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Preparation before injection
> “Ensure HIBSAGO has been at room temperature (below 86°F [30°C]) for a minimum of 30 minutes prior to injection”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Material safety data sheet
No evidence found.
##### 2.1.2.3 Average Sales Price and Wholesale Acquisition Cost
###### Wholesale acquisition cost published at or after approval
No evidence found.
###### Company statement on the timing of the U.S. list price
> “adding that the drug’s list price will become public once pricing and reimbursement discussions have wrapped with payers”
> “We price our medicines according to the value and outcomes they bring to patients, providers and payers while being sensitive to current market and societal expectations”
Source: [Fierce Pharma (2026)](https://www.fiercepharma.com/pharma/gsk-brings-promise-functional-cure-hepatitis-b-finish-line-fda-nod-hibsago)
###### Royalties payable to Ionis on net sales
> “Under the terms of the agreement, Ionis has received an upfront payment, license fee and development and regulatory milestone payments and is eligible to receive additional regulatory and sales milestone payments as well as tiered royalties of 10-12% on net sales of bepirovirsen.”
Source: [Ionis press release, Hibsago US approval (2026)](https://ir.ionis.com/news-releases/news-release-details/ionis-partner-gsk-announces-hibsago-bepirovirsen-approved-us)
###### Average sales price
No evidence found.
###### Japan National Health Insurance price listing, October 2026
> “新医薬品一覧表（令和８年１０月１４日収載予定）”
> “ヒブサーゴ皮下注１５０ｍｇシリンジ（１５０ｍｇ１ｍＬ１筒）”
> “１５０ｍｇ１ｍＬ１筒 １８３，０１５円”
> “製造販売承認日 令和８年８月２４日 薬価基準収載予定日 令和８年１０月１４日”
> “最初に承認された国（年月）：日本”
Source: [MHLW Chuikyo new drug price listing (2026)](https://www.mhlw.go.jp/content/10808000/001756860.pdf)
###### Japan price calculation method and absence of a comparator
> “算定方式 原価計算方式”
> “本剤の効能又は効果である「Ｂ型肝炎ウイルス持続感染における機能的治癒」の適応を有する既収載品はなく、本剤と同様の薬理作用、化学構造を有する既収載品もないことから、薬価算定上の最類似薬はないと判断した。”
Source: [MHLW Chuikyo new drug price listing (2026)](https://www.mhlw.go.jp/content/10808000/001756860.pdf)
###### Japan cost accounting components of the listed price per 150 mg syringe
| Component | Value |
|---|---|
| Total product cost | “１３０，７３３円” |
| Operating profit | “２４，１６４円” “（流通経費を除く価格の１５．６％）” |
| Distribution cost | “１１，４８０円” “（消費税を除く価格の６．９％）” |
| Consumption tax | “１６，６３８円” |
| Price before and after premiums | “１８３，０１５円 → １８３，０１５円” |
Source: [MHLW Chuikyo new drug price listing (2026)](https://www.mhlw.go.jp/content/10808000/001756860.pdf)
###### Japan price premiums assessed and premium coefficient of zero
> “補正加算 有用性加算（Ⅰ）（Ａ＝５０％）、先駆加算（Ａ＝１０％） 加算係数 ０”
> “本剤はＨＢＶ由来のｍＲＮＡに結合することでタンパク質の産生を阻害するＢ型肝炎治療薬であり、既存薬とは異なる約２６年ぶりの新規作用機序医薬品であること、既存治療で効果が不十分な患者を対象とした臨床試験において、既存治療では稀であった機能的治癒の達成を認めていること等から、有用性加算（Ⅰ）（Ａ＝５０％）を適用することが適当と判断した。”
> “本品は世界に先駆けて日本で承認されたものであることから、加算の要件を満たす。一方で、本剤の承認申請に係る臨床試験における日本人患者の組み入れ数は諸外国と比較し、特別優れているわけではないことから、限定的な評価とした。”
Source: [MHLW Chuikyo new drug price listing (2026)](https://www.mhlw.go.jp/content/10808000/001756860.pdf)
###### Japan price maintenance premium and cost-effectiveness evaluation designation
> “革新的新薬薬価維持制度への該当性 該当する（主な理由：加算適用）”
> “費用対効果評価への該当性該当する（Ｈ１）”
Source: [MHLW Chuikyo new drug price listing (2026)](https://www.mhlw.go.jp/content/10808000/001756860.pdf)
###### Japan standard drug cost per administration for inpatient DPC payment
> “通常、成人にはベピロビルセンとして1回300mgを投与1週目及び2週目は3～4日毎に週2回、投与3週目以降は24週目まで週1回、皮下注射する。”
> “366,030円/回”
> “このほかに併用薬の費用がかかる。”
> “令和８年10月14日に薬価収載を予定している医薬品等のうち以下に掲げるものは、上記基準に該当する。よって、これらの薬剤を使用した患者であって当該薬剤に対応する診断群分類に該当するものについては、次期診療報酬改定までの間、出来高算定することとしてはどうか。”
Source: [MHLW Chuikyo DPC high-cost new drugs (2026)](https://www.mhlw.go.jp/content/10808000/001756861.pdf)
##### 2.1.2.4 American Hospital Formulary Service (AHFS), or Other Drug Classification
###### AHFS classification
No evidence found.
###### ATC classification
No evidence found.
###### USP category and class
No evidence found.
###### Pharmacologic class stated in the prescribing information
> “HIBSAGO (bepirovirsen) injection is a hepatitis B virus (HBV) messenger RNA-directed antisense oligonucleotide.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### KEGG DRUG classification
| Field | Quoted record |
| --- | --- |
| Efficacy | “Antiviral” |
| Type | “Antisense oligonucleotide” |
| Comment | “Treatment of hepatitis B virus (HBV) infection” |
| Target | “HBV mRNA” |
| Brite hierarchy, level 1 | “Antimicrobials” |
| Brite hierarchy, level 2 | “Antivirals” |
| Brite hierarchy, level 3 | “Polyprotein cleavage inhibitor” |
| Brite hierarchy, level 4 | “HBV mRNA antisense” |
Source: [KEGG DRUG D12615](https://www.kegg.jp/entry/D12615)
###### Therapeutic category of drugs in Japan
| Field | Quoted record |
| --- | --- |
| Therapeutic category code | “6250” |
| Category, level 1 | “Agents against pathologic organisms and parasites” |
| Category, level 2 | “Chemotherapeutics” |
| Category, level 3 | “Antivirals” |
Source: [KEGG DRUG D12615](https://www.kegg.jp/entry/D12615)
##### 2.1.2.5 Indication
###### U.S. indication: full prescribing information
> “HIBSAGO is indicated in combination with nucleos(t)ide analog reverse transcriptase inhibitor (NrtI) therapy for treatment of chronic hepatitis B virus (HBV) infection in adult patients without cirrhosis:”
> “who have been on NrtI therapy for at least 6 months and have suppressed HBV deoxyribonucleic acid (DNA), and”
> “who have HBV surface antigen (HBsAg) levels less than or equal to 3,000 IU/mL as determined by an FDA-authorized test”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### U.S. indication: Highlights of prescribing information
> “HIBSAGO is a hepatitis B virus (HBV) mRNA-directed antisense oligonucleotide (ASO) indicated in combination with nucleos(t)ide analog reverse transcriptase inhibitor (NrtI) therapy for treatment of chronic HBV infection in adult patients without cirrhosis:”
> “HIBSAGO is administered by subcutaneous injection and must be used in combination with NrtI therapy.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### U.S. indication: FDA-approved use on the novel drug approvals list
> “To treat chronic hepatitis B virus infection in certain adults without cirrhosis, in combination with existing antiviral therapy”
Source: [FDA Novel Drug Approvals for 2026 (2026)](https://www.fda.gov/drugs/novel-drug-approvals-fda/novel-drug-approvals-2026)
###### U.S. indication: FDA plain-language description
> “Hibsago is approved for certain adults without cirrhosis who have been taking HBV antiviral therapy for at least six months, have suppressed levels of HBV in their blood and have hepatitis B surface antigen (HBsAg) levels of 3,000 IU/mL or less, as determined by an FDA-authorized test.”
> “Hibsago is injected under the skin for up to 24 weeks. Patients take it alongside their existing hepatitis B medicine and continue that medicine for at least 24 weeks after their last Hibsago injection.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
###### U.S. indication: patient information wording
> “HIBSAGO is a prescription medicine used with other medicines called nucleos(t)ide analog reverse transcriptase inhibitors (NrtIs), to treat adults with chronic (long-term) hepatitis B virus (HBV) infection without advanced liver disease (cirrhosis):”
> “who have been on NrtI treatment for at least 6 months and have undetectable HBV deoxyribonucleic acid (DNA),”
> “who have low levels of HBV surface antigen (HBsAg less than or equal to 3,000 IU/mL)”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### U.S. indication: partner company wording
> “HIBSAGO is indicated in combination with nucleos(t)ide analogue reverse transcriptase inhibitor (NrtI) therapy to treat chronic hepatitis B virus (HBV) infection in adults without cirrhosis who have been on NrtI therapy for ≥6 months with suppressed HBV DNA and who have HBV surface antigen (HBsAg) levels ≤3,000 IU/mL as determined by an FDA-authorized test.”
Source: [Ionis press release, Hibsago US approval (2026)](https://ir.ionis.com/news-releases/news-release-details/ionis-partner-gsk-announces-hibsago-bepirovirsen-approved-us)
###### Baseline HBsAg testing required for patient selection
> “Prior to initiation of HIBSAGO for treatment of chronic HBV infection, test all patients to quantify HBsAg levels in serum or plasma to identify patients with baseline HBsAg levels less than or equal to 3,000 IU/mL”
> “Information on FDA-authorized tests for the quantification of HBsAg levels is available at:”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Populations excluded from or not studied under the indication
> “Patients with acute hepatic impairment, or cirrhosis who have mild, moderate, or severe hepatic impairment (Child-Pugh Class A, B or C)”
> “Patients with platelet count below 100 x 109/L prior to initiation of treatment”
> “HIBSAGO is not recommended in patients with Hepatitis D Virus (HDV) coinfection due to the potential for an exacerbated risk of clinically significant ALT increases.”
> “The safety and effectiveness of HIBSAGO have not been established in patients less than 18 years of age.”
> “It is not known if HIBSAGO is safe and effective in people who also have hepatitis C virus (HCV) or hepatitis D virus (HDV) infection.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Japan indication
> “GSK plc (LSE/NYSE: GSK) today announced that Japan’s Ministry of Health, Labour and Welfare (MHLW) has approved Hibsago (bepirovirsen), an antisense oligonucleotide (ASO), as a functional cure for chronic hepatitis B (CHB) virus infection in adult patients who have received at least 6 months of prior nucleos(t)ide analogue therapy and meet pre-defined viral markers”
> “Hibsago (bepirovirsen) has been approved as a functional cure in chronic hepatitis B (CHB) virus infection in patients who have received nucleos (t) ide analogue therapy for at least 6 months before starting this drug and whose HBs antigen level at starting this drug is ≤ 3000 IU/mL and HBV DNA level is < 90 IU/mL (1.95logIU/mL).”
Source: [GSK press release, Hibsago Japan approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-japan-as-first-and-only-functional-cure-for-chronic-hepatitis-b/)
##### 2.1.2.6 Pharmacology
###### 2.1.2.6.1 Mechanism of Action
###### Pharmacologic class: HBV messenger RNA-directed antisense oligonucleotide
> “HIBSAGO (bepirovirsen) injection is a hepatitis B virus (HBV) messenger RNA-directed antisense oligonucleotide.”
> “HIBSAGO is an antiviral drug against HBV [see Microbiology (12.4)].”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Gapmer chemistry and RNase H1-mediated degradation of HBV RNA
> “Bepirovirsen is a synthetic, single-stranded, chimeric antisense oligonucleotide (ASO) with a gapmer architecture consisting of five 2′-O-(2-methoxyethyl) (2′-MOE)-modified ribonucleotide wings flanking a central 10-deoxynucleotide gap with phosphorothioate linkages throughout.”
> “Bepirovirsen is designed to bind a conserved 20-nucleotide site”
> “present in HBV mRNAs (including the pregenomic RNA [pgRNA], precore, preS1, preS2/S, and X mRNAs), forming a DNA:RNA heteroduplex that recruits endogenous ribonuclease H1 (RNase H1) to catalyze irreversible hydrolysis of the viral RNA strand at the 3’-O-P bonds, resulting in degradation of HBV mRNA and reduction in HBV DNA and viral proteins, including HBsAg.”
> “The 20-nucleotide binding site is present within transcripts derived from both cccDNA and integrated HBV DNA.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Binding site sequence and RNase H cleavage: phase 2a publication
> “Bepirovirsen (previously ISIS 505358; GSK3228836) is an antisense oligonucleotide (ASO) with a 2′-O-methoxyethyl (2′-MOE) gapmer design (full sequence is publicly available)13.”
> “The bepirovirsen binding site (GCACTTCGCTTCACCTCTGC) is present in all HBV mRNA and pregenomic RNA; as such, bepirovirsen would be expected to reduce levels of all HBV mRNAs including pregenomic RNA.”
> “Specific ASOs bind to complementary HBV RNA transcripts forming a hybrid ASO/RNA complex, which recruits endogenous RNase H, cleaving the HBV RNA and leading to degradation of the transcript.”
Source: [Yuen et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8516644/)
###### Target in transcripts from integrated HBV DNA: HBeAg-negative participants
> “The substantial reduction of HBsAg in HBeAg-negative patients suggests that the bepirovirsen target site is preserved in the majority of transcripts derived from integrated HBV genomes.”
Source: [Yuen et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8516644/)
###### Conservation of the target site across HBV genotypes
> “Conservation of the bepirovirsen target site across HBV genotypes indicates broad antiviral activity.”
> “Bioinformatic analysis of 9,139 HBV genomes in the HBV database showed that the target sequence is conserved across genotypes A-H and recombinant forms, with full identity to 97.6% of sequences, and to 99.7% of sequences when allowing for one nucleotide mismatch.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Antiviral activity in cell culture
> “Bepirovirsen reduced the level of HBV RNA transcripts in a dose-dependent manner in HepG2.2.15 cells (HBV genotype D) using transfection-based delivery resulting in EC50 values of 70 nM (16 hours) and 122 nM (48 hours) as measured by two RT-qPCR primer/probe sets targeting pgRNA, preS1, and preS2/S mRNAs.”
> “In HepG2.2.15 cells (HBV genotype D, transfection-based delivery), bepirovirsen reduced intracellular HBV DNA with EC50 values of approximately 171 nM and 53 nM by qPCR at 48 and 96 hours, respectively, and inhibited extracellular HBsAg and HBeAg secretion with EC50 values of approximately 138 nM and 296 nM by ELISA at 48 hours, respectively.”
> “In primary human hepatocytes (HBV genotype D, free uptake), 4 doses of bepirovirsen every ~72 to 96 hours inhibited extracellular HBsAg and HBeAg secretion with EC50 values of 47.1±0.7 nM and 29.8±2.9 nM, respectively, as assessed by ELISA ~96 hours after the last dose.”
> “Bepirovirsen inhibited extracellular HBsAg with an EC50 value of approximately 0.20–0.30 nM by chemiluminescent immunoassay (HBV genotype A; at ~96 hours) and reduced intracellular HBV DNA by approximately 3.5 to 5 log10 across genotypes A, B, C, and D by qPCR (at ~48 hours) at a fixed molar ratio.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Combination with nucleos(t)ide analogues in cell culture
> “Combining bepirovirsen with entecavir or tenofovir disoproxil fumarate in HepG2.2.15 cells (HBV genotype D, transfection-based delivery) resulted in no antagonism and greater reductions of intracellular HBV DNA by qPCR compared to the individual drugs.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Unconjugated design and uptake by non-parenchymal liver cells
> “Bepirovirsen is unconjugated,6 in contrast to small-interfering RNAs currently in development, which are conjugated to a N-acetylgalactosamine (GalNAc) for targeted delivery to hepatocytes.7 This unconjugated design may facilitate delivery to and uptake by a broader range of cells within the liver, including non-parenchymal cells, such as liver-resident macrophages (Kupffer cells) and endothelial cells.8”
> “Notably, bepirovirsen demonstrated superior efficacy to GSK3389404, its GalNAc-conjugate, in phase II clinical trials, suggesting a possible advantage in engaging a broader array of liver cells.4,10”
Source: [Ermler et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13482607/)
###### Innate immune activation through human TLR8 as a second mechanism
> “Clinical and preclinical data demonstrate that bepirovirsen elicits an innate immune response, evidenced by induction of inflammatory cytokines. This effect is mediated at least in part by TLR8 activation, complementing its established antiviral mechanism.”
> “This study demonstrates that bepirovirsen can induce an innate immune response, likely through TLR8 agonism, in addition to its known antiviral mechanism; however, the clinical impact of this immunomodulatory effect remains unclear and requires further investigation.”
Source: [Ermler et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13482607/)
###### Three proposed effects on HBV infection
> “Bepirovirsen binds to a complementary sequence present in all HBV messenger RNA transcripts and targets all HBV RNAs (including pregenomic RNA), impacting HBV infection in 3 ways: reductions in viral proteins, including HBsAg; reductions in HBV DNA; and stimulation of the immune system, potentially via Toll‐like receptor 8 activation.”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### Immune-mediated killing of infected hepatocytes: B-Together biomarker analysis
> “These findings provide evidence that bepirovirsen may modulate the immune system to facilitate infected hepatocyte killing in chronic HBV infection in addition to its direct antiviral effects; therefore, ALT increases could reflect a therapeutic response to bepirovirsen.”
Source: [Joshi et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12923464/)
###### 2.1.2.6.2 Pharmacodynamics
###### Exposure-response relationship in B-Well 1 and B-Well 2
> “Within the range of bepirovirsen exposures achieved at the dosing regimen in B-Well 1 and B-Well 2 trials, variability in bepirovirsen plasma exposure was not identified as a determinant of treatment response at Week 72.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Immunostimulant activity: nonclinical studies in the prescribing information
> “In nonclinical studies, bepirovirsen exhibited innate immune activity in a sequence-specific, human toll-like receptor 8 (hTLR8)-dependent manner, with no activity observed at other pattern recognition receptors tested.”
> “Compared to wild-type mice, hTLR8 knock-in mice showed increased proinflammatory cytokine expression upon bepirovirsen treatment. This immunostimulatory activity was predominantly localized to hepatic macrophages and Kupffer cells, with induction of cytokines including TNF-α, IL-12p40, and CXCL10.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Immune markers in clinical studies: prescribing information
> “In clinical studies, administration of HIBSAGO was associated with increases in innate immune markers of activation and trafficking, which included cytokines and chemokines (e.g., interleukin12, tumor necrosis factor, interferon gamma and CXC motif chemokine ligand 9 and 10). Treatment with HIBSAGO also increased total IgM.”
> “The contribution of immunostimulatory activity to antiviral activity at therapeutic concentrations in humans has not been fully determined.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### TLR8 reporter cell lines and hTLR8 transgenic mice
> “Analysis of innate immune activation in PRR-overexpressing cells revealed a weak but statistically significant (p = 0.00085) induction only in the presence of human Toll-like receptor 8 (TLR8). In hTLR8 transgenic mice – but not wild-type mice – bepirovirsen treatment induced pro-inflammatory cytokines, similar to the TLR8 agonist selgantolimod. Kupffer cells and macrophages were identified as the primary responders to bepirovirsen in the livers of hTLR8 mice.”
> “Notably, induction of type I IFN (IFN-α or IFN-β) did not occur with bepirovirsen in hTLR8 mice.”
Source: [Ermler et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13482607/)
###### Cytokine induction in the phase 2a study
> “At 24 h following bepirovirsen treatment (Fig. 1B), key cytokines known to regulate pro-inflammatory and antiviral processes, such as IFN-γ and TNF, as well as others that induce macrophage and neutrophil (CCL2, CCL4, CSF1, CSF3) or T cell (IL-12B, CCL19) recruitment and activation, were among the upregulated analytes in bepirovirsen-treated individuals.”
> “Compared with the non-responder group, the responder group showed trends towards increased activity in the IFN-γ signaling and T-cell response pathways.”
Source: [Ermler et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13482607/)
###### Innate immune proteins in healthy volunteers and participants with chronic HBV infection
> “Bepirovirsen induced significant, transient protein differential expression in the hours after dosing, while there were relatively minor changes in placebo. There were many similarities in protein biomarkers induced in CS3 participants with chronic HBV infection and in the two healthy volunteer studies. Additionally, bepirovirsen treatment increased abundance of many proteins to a higher degree with increasing dose.”
> “These findings strengthen the association between bepirovirsen treatment and changes in innate immune-related proteins and indicate that this effect does not require the presence of HBV.”
Source: [Delahaye et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13676563/)
###### Serum proteomics and transcriptomics in B-Together
> “Increases from baseline in mean expression of serum proteins with immune effector and apoptotic functions (Week 3) and transcripts associated with immune cell proliferation and activation (Week 5) were observed regardless of arm or response subgroup. By Week 8, serum liver and apoptosis-specific proteins were increased; this was more pronounced in responders than non-responders, with the difference more marked in Arm 1 versus Arm 2. Increased abundance of these proteins was highly correlated with ALT levels, which were often associated with transient hepatitis B virus (HBV) DNA elevations and HBsAg decreases.”
Source: [Joshi et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12923464/)
###### HBsAg and HBV DNA reduction after 4 weeks of treatment: phase 2a study
> “For treatment-naïve patients, the mean (s.d.) HBsAg reduction from baseline to day 29 was 0.50 (0.57) log10 IU ml−1 (P = 0.245 versus placebo) and 1.56 (1.38) log10 IU ml−1 (P = 0.001 versus placebo) in the bepirovirsen 150 mg and 300 mg arms, respectively (Table 3). For on-NA patients, the mean (s.d.) HBsAg reduction to day 29 was 1.99 (1.80) log10 IU ml−1 (Table 3). By contrast, no placebo-treated patient had a reduction in HBsAg of >0.07 log10 IU ml−1 by day 29.”
> “The mean (s.d.) HBV DNA reduction from baseline to day 29 was 0.38 (0.42) log10 IU ml−1 (P = 0.116 versus placebo) and 1.66 (1.48) log10 IU ml−1 (P < 0.001 versus placebo) in the bepirovirsen 150 mg and 300 mg arms, respectively (Table 3).”
Source: [Yuen et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8516644/)
###### HBsAg decline during 24 weeks of treatment: B-Clear
> “In group 1, 43 participants (63%) receiving NA therapy and 41 (59%) not receiving NA therapy had an HBsAg level of less than 100 IU per milliliter by the end of treatment; the values were 26 (38%) and 20 (29%), respectively, at 24 weeks after the end of treatment (Figure 2). By the end of treatment in group 1, a total of 18 participants (26%) receiving NA therapy and 20 (29%) not receiving NA therapy had an HBsAg level below the lower limit of detection; at 24 weeks after the end of treatment, the values were 8 (12%) and 10 (14%), respectively (Figure 2 and Fig. S10).”
> “Decreases in HBsAg and HBV DNA levels were dependent on the duration of bepirovirsen treatment (Figs. S5 and S6).”
Source: [Yuen et al. (2022)](https://www.nejm.org/doi/full/10.1056/NEJMoa2210027)
###### Week 12 HBsAg below 1 IU/mL as an early on-treatment marker
> “An early on-treatment response defined as HBsAg <1 IU/mL at Treatment Week 12 was identified as a predictor of achieving the primary efficacy endpoint with HIBSAGO treatment [see Dosage and Administration (2.3)].”
> “Among participants with baseline HBsAg ≤3,000 IU/mL who met this criterion, 34% (203/601) had sustained suppression of HBV DNA and HBsAg not detected at 24 weeks after cessation of all chronic HBV treatment.”
> “Participants who did not meet this criterion (who had HBsAg ≥1 IU/mL at Week 12) had a 2% (9/498) probability of having sustained suppression of HBV DNA and HBsAg not detected at 24 weeks after cessation of all chronic HBV treatment.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### ALT flares temporally associated with HBsAg decline
> “HIBSAGO may cause on-treatment hepatic flares with increases in ALT of >20-40x ULN associated with decline in HBsAg.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “Reductions in HBsAg either preceded the ALT increases or occurred concomitantly with ALT flares (Fig. 3a–d and Supplementary Fig. 4). Generally, larger ALT increases (based on peak ALT) were associated with greater HBsAg reductions (Fig. 3e and Supplementary Fig. 6).”
> “By contrast, no ALT flares were observed in patients without a HBsAg reduction (<0.2 log10) or in patients receiving placebo.”
Source: [Yuen et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8516644/)
###### ALT increases to at least 3 times the upper limit of normal: B-Clear
> “Overall, 39 of 225 participants receiving NA therapy (17%) and 93 of 227 not receiving NA therapy (41%) had a transient increase in the ALT level to at least 3 times the upper limit of the normal range between randomization and the end of follow-up (Table S6).”
> “In patients with HBV, ALT flares can be a result of disease activity, immune clearance of HBV-infected hepatocytes, or drug-induced liver injury.”
Source: [Yuen et al. (2022)](https://www.nejm.org/doi/full/10.1056/NEJMoa2210027)
###### C-reactive protein increases after the first dose
> “Six (50%) bepirovirsen‐treated participants in the single‐dose cohorts and 9 (100%) in the multiple‐dose cohorts had transient increases in C‐reactive protein (CRP) (single‐dose, Figure S11A; multiple‐dose, Figure 3A–D).”
> “Peak CRP levels ranged from 4.2 to 53.3 mg/L; those with peak CRP levels >10 mg/L (n = 5 for single‐dose; n = 6 for multiple‐dose) were reported as treatment‐emergent AEs. These increases were not associated with symptoms, and no participants had chronic CRP elevation.”
Source: [Han et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9804925/)
> “An increase in C-reactive protein (CRP) levels following the first dose of bepirovirsen was observed in patients with CHB.”
> “CRP elevations were dose-related in patients and were consistent with those observed in healthy volunteers (Supplementary Fig. 3b and unpublished data).”
Source: [Yuen et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8516644/)
###### Cardiac electrophysiology at supratherapeutic doses
> “At supratherapeutic doses of 450 or 600 mg (1.5 and 2 times the recommended dosage) of HIBSAGO, clinically significant QTc interval prolongation was not observed.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Placebo-corrected QTcF change at Cmax: thorough QT study
| Arm | Participants analyzed | Placebo-corrected change from baseline in QTcF, geometric mean (90% CI), milliseconds |
| --- | --- | --- |
| Bepirovirsen, four subcutaneous injections | “5” | “2.360” “(-0.249 to 4.970)” |
| Bepirovirsen, three subcutaneous injections | “18” | “2.024” “(-0.541 to 4.589)” |
Source: [ClinicalTrials.gov NCT06422767](https://clinicaltrials.gov/study/NCT06422767?tab=results)
###### Response by HBV genotype and baseline HBsAg in B-Well 1 and B-Well 2
> “Overall response rates were 28% for genotype A, 21% for genotype B, 20% for genotype D, and 15% for genotype C. Response rates declined with increasing baseline HBsAg levels and fell below 10% for genotypes B and C at baseline HBsAg levels exceeding 1,000 IU/mL.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Resistance: binding-site polymorphisms in B-Well 1 and B-Well 2
| Trial and baseline HBsAg stratum | Baseline nucleotide polymorphisms, % (n/N) | Treatment-emergent nucleotide mutations, % (n/N) |
| --- | --- | --- |
| B-Well 1, baseline HBsAg ≤3,000 IU/mL | “6 (7/123)” | “5 (2/42)” |
| B-Well 2, baseline HBsAg ≤3,000 IU/mL | “7 (7/104)” | “6 (2/31)” |
| B-Well 1, baseline HBsAg ≤1,000 IU/mL | “3 (2/69)” | “5 (1/22)” |
| B-Well 2, baseline HBsAg ≤1,000 IU/mL | “12 (6/50)” | “0 (0/10)” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Resistance: phenotypic susceptibility of binding-site variants
> “Cell culture based phenotypic testing of baseline and treatment emergent variants identified in HIBSAGO clinical trials indicated 1.2- to 4.1-fold reductions in susceptibility relative to wild-type based on HBsAg inhibition in primary human hepatocytes.”
> “Approximate EC50 fold-changes for individual variants relative to wild-type were: G1588A (2.8-fold), C1589A (4.1-fold), T1590A (1.8-fold), T1590G (3.0-fold), C1595T (2.3-fold), and C1600T (1.2-fold). The clinical impact of reduced susceptibility to HIBSAGO in these variants is unknown.”
> “Deep mutational scanning identified resistance-conferring mutations predominantly within the central DNA gap region of the bepirovirsen target sequence; mutations in the 2’-MOE-modified wing regions had minimal effect on susceptibility.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Resistance: binding-site polymorphisms and response in B-Clear
> “Baseline SNPs were identified in 7% (22/309) of participants. These participants showed numerically smaller HBsAg reductions than those without SNPs, but 18% (4/22) achieved transient HBsAg loss.”
> “Of 16 post-baseline SNPs, eight were treatment-emergent.”
> “Findings from this phase IIb clinical study demonstrate that the vast majority (92%) of non-responders, partial responders, or relapsers did not harbor bepirovirsen binding site SNPs.”
> “These results suggest that routine testing for specific HBV variants prior to bepirovirsen administration is not currently warranted, and that resistance due to altered sequence complementarity is likely minimal and multifactorial.”
Source: [Bouquet et al. (2026)](https://doi.org/10.1016/j.jhep.2025.12.025)
###### Cross-resistance with nucleos(t)ide analogue reverse transcriptase inhibitors
> “Cross-resistance between bepirovirsen and NrtIs including entecavir and tenofovir is not expected. The bepirovirsen target site (encoding polymerase amino acid residues 832–839) is located in a region distinct from the reverse transcriptase domain associated with NrtI resistance substitutions (polymerase amino acid residues 385–605). The bepirovirsen target site does not overlap with HBV vaccine epitope coding sequences.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Preclinical pharmacology: HBV-transgenic mice and human dose prediction
> “Bepirovirsen dose‐dependently reduced hepatic expression of HBV RNA in HBV transgenic mice, with a maximal reduction >90% achieved following a dose of 50 mg/kg/week (Figure S4A).”
> “Maximal reduction of serum HBsAg was ≈99% (2 logs).”
> “The preclinical transgenic mouse model showed that the 90% effective dose for HBsAg reduction was ≈20 mg/kg, which corresponds to a plasma PK exposure equivalent dose of 280 mg (4 mg/kg) of bepirovirsen in humans.”
Source: [Han et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9804925/)
###### 2.1.2.6.3 Pharmacokinetics
###### Pharmacokinetic properties of bepirovirsen 300 mg: prescribing information
| Parameter | Prescribing information |
| --- | --- |
| Cmax (mcg/mL), arithmetic mean (SD) | “9.14 (2.19)” |
| AUC0-tau (mcg*hour/mL), arithmetic mean (SD) | “102 (34.3)” |
| Ctrough (mcg/mL), arithmetic mean (SD) | “0.022 (0.045)” |
| Dose proportionality | “Exposure increased in proportion to dose over the range of 150 to 300 mg weekly dosing” |
| Time to steady state | “Steady state concentration is reached by Day 8 following 300 mg weekly dosing with loading doses during Weeks 1 and 2” |
| Accumulation | “No accumulation was observed with 300 mg weekly dosing for 24 weeks” |
| Tmax (hours), observed median (min-max) | “3 (2-5)” |
| Vss/F (L), geometric mean (CV%) | “73 (46.3)” |
| Plasma protein binding | “99% at 5 mcg/mL” “95% at 150 mcg/mL” |
| Terminal half-life (days), observed median (min-max) | “29 (8-192)” |
| Clearance/F (L/hour), geometric mean (CV%) | “3.05 (25.7)” |
| Metabolism, primary pathway | “Metabolized in tissues by endonucleases to form shorter oligonucleotides that are then substrates for additional metabolism by exonucleases” |
| Excretion | “Oligonucleotide fragments are expected to be excreted by the kidney” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Basis of the values in the pharmacokinetic properties table
> “Pharmacokinetic parameters are presented as arithmetic mean (SD), derived from population PK model simulations at steady state following subcutaneous administration of HIBSAGO 300 mg weekly in participants with chronic HBV infection (CHB).”
> “Pharmacokinetic parameters are presented as geometric mean (CV%) from post-hoc individual estimates from Phase 3 population PK model.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Covariates: race, ethnicity, age, sex, body weight, injection site, and anti-drug antibodies
> “Based on population pharmacokinetic analyses, following subcutaneous administration, there were no clinically meaningful changes in the pharmacokinetics of bepirovirsen by race (Asian, Black, White, Other), ethnicity,”
> “age (18-87 years old), sex, body weight (39 kg to 148 kg), injection site location (thigh, upper arm, abdomen) and anti-drug antibodies (ADA) status.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Immunogenicity: anti-drug antibodies and clearance
> “In the Phase 3 B-Well trials, 43% (517/1,203) of participants treated with HIBSAGO tested positive for ADAs. The presence of ADAs resulted in a 26.6% lower systemic clearance of bepirovirsen. The development of these antibodies did not appear to be associated with a reduced treatment response or differences in the safety profile.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Single and multiple doses in healthy volunteers: absorption, distribution, and elimination
> “Following a single SC injection in all cohorts at all dose levels, the concentration‐time profile of bepirovirsen featured a rapid absorption phase, followed by an initial rapid distribution phase and a slower elimination phase (Figure 2). Median bepirovirsen tmax ranged from 3 to 8 hours after dosing across all cohorts and study days (Table 1).”
> “Following a single SC injection of bepirovirsen, Cmax and total exposure, expressed as the AUC, increased with increasing dose (Table 1) and appeared to be dose proportional between 150 mg and 450 mg but were lower than dose proportional between 75 mg and 150 mg (Table 1).”
> “Following the final dose on study day 22, the mean terminal plasma elimination half‐life was 22.4 to 24.2 days across cohorts.”
> “Within the first 24 hours after dosing, urinary excretion of intact full‐length bepirovirsen accounted for <2% of the administered dose across all dose levels evaluated.”
Source: [Han et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9804925/)
###### Plasma parameters of the 300 mg cohorts in healthy volunteers
| Cohort and study day | Cmax (µg/mL), mean (SD) | tmax (h), median (range) | AUC0-24h (µg • h/mL), mean (SD) | CL/F (L/h), mean (SD) | t1/2 (days), mean (SD) |
| --- | --- | --- | --- | --- | --- |
| Single dose 300 mg, day 1 | “9.47 (0.34)” | “8 (6–8)” | “112 (5.71)” | “2.50 (0.13)” | “NA” |
| Multiple dose 300 mg, day 1 | “9.25 (2.13)” | “6 (4–8)” | “123 (3.04)” | “NA” | “NA” |
| Multiple dose 300 mg, day 22 | “7.93 (2.23)” | “6 (4–8)” | “103 (19.4)” | “2.03 (0.21)” | “24.2 (6.06)” |
Source: [Han et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9804925/)
###### Population pharmacokinetic model: phase 1, 2a, and 2b data
> “Bepirovirsen PK data were well-described by a linear, three-compartment model with first-order absorption and absorption delay. Chronic HBV infection status, body weight, and Asian versus non-Asian race were key covariates included in the final model.”
> “In simulations, bepirovirsen systemic exposure was dosed proportionally and predicted to be almost completely washed out by 12 weeks following the final 300-mg dose. Differences in body weight, Asian race, or disease status did not result in clinically relevant differences in exposure.”
> “The lack of clinically relevant differences seen in exposure indicate that dose adjustments are not recommended for bepirovirsen based on demographics or clinical characteristics.”
Source: [Youssef et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11219612/)
###### Population pharmacokinetic model: effect of body weight and washout after 24 weeks
> “When body weight increased from 40 to 100 kg, the median (90% CI) for AUCtau decreased from 131.0 (78.4, 209.0) to 83.2 µg·h/ml (49.8, 133.0), Cmax reduced from 12.5 (6.3, 23.2) to 6.6 µg/ml (3.4, 11.9), and Ctrough from 0.0383 (0.0217, 0.0686) to 0.0160 µg/ml (0.0090, 0.0289). However, the ranges were not considered clinically relevant.”
> “In participants who received bepirovirsen 300 mg weekly for 24 weeks, the median (95% CI) predicted concentration at week 36 was 93% lower than at the end of treatment (week 24: 0.0224 [0.0113, 0.0461] µg/ml versus week 36: 0.0017 [0.000048, 0.0102] µg/ml).”
Source: [Youssef et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11219612/)
###### Relative bioavailability of the vial and the prefilled syringe
> “Analysis of the primary endpoint demonstrated the bioequivalence of bepirovirsen exposure from a vial versus PFS SSD when HCP‐administered, as the GMR (90% CI) was 1.02 (0.91, 1.14) for Cmax and 1.05 (0.96, 1.15) for AUC(0‐inf) (Table 3).”
> “The GMR (90% CI) with participant training (Group 2 versus Group 3) was 1.02 (0.88, 1.18) for Cmax and 0.98 (0.88, 1.09) for AUC(0‐inf), and without participant training (Group 2 versus Group 4) was 0.99 (0.87, 1.13) for Cmax and 0.97 (0.87, 1.08) for AUC(0‐inf).”
Source: [Youssef et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12856967/)
###### Body weight and injection site: single 300 mg dose in healthy participants
> “The geometric mean bepirovirsen Cmax and AUC(0‐inf) decreased with increasing body weight. Between the 50‐<70kg and ≥80kg groups, there was a decrease of 24%‐47% in geometric mean Cmax and a decrease of 19%‐43% in geometric mean AUC(0‐inf).”
> “Across all treatment groups the geometric mean Cmax of bepirovirsen tended to be lower when administered in the thigh compared with the other injection sites.”
Source: [Youssef et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12856967/)
###### Liver distribution and intracellular sequestration
> “Based on extrapolations from concentration measurements in preclinical species, the total liver concentration of bepirovirsen at steady state was estimated to be 34.8 µM, which seems, on first appearance, to be higher than the plasma. However, when the distribution between the hepatocytes and nonparenchymal cells is factored in, only 15% (5 µM) of the liver concentration is associated with the hepatocytes. Furthermore, multiple sources estimate that greater than 98% of the concentration of the drug in the hepatocytes is sequestered in the endo‐lysosomal system,”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### Tissue localization in mice: liver and kidney
> “Bepirovirsen was localized primarily in nonparenchymal liver cells and proximal renal tubules.”
> “Positive liver signal was quantified using HALO AI, with 12.9% of the ASO localized to the hepatocytes and 87.1% in nonparenchymal cells.”
Source: [Spencer-Dene et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10578491/)
###### Physiologically based pharmacokinetic model: predicted liver and kidney exposure
> “Liver and kidney partition coefficients were calculated to be 2147 and 2822, respectively.”
> “Predicted vs. observed clearance (L/h), AUC0-inf (µg.h/mL) and Cmax (µg/mL) for the 300 mg single dose in healthy volunteers were 2.94, 114.43, and 10.56 vs. 2.25, 136.6, and 6.5, respectively.”
> “The PBPK model predicted the liver and kidney tissue Cmax values to be 172 and 132 µg/mL, respectively.”
Source: [Salem et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/41826491/)
###### Renal impairment: pharmacokinetics
> “Renal Impairment: Bepirovirsen pharmacokinetics were similar between patients with CHB with an eGFR 60 to 89 mL/min/1.73m2 compared to patients with an eGFR ≥90 mL/min/1.73 m2. Insufficient data are available in patients with moderate or severe renal impairment.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Hepatic impairment: pharmacokinetics
> “Hepatic Impairment: The pharmacokinetics of bepirovirsen have not been evaluated in CHB patients with hepatic impairment (Child-Pugh Class A, B, or C) [see Contraindications (4)].”
> “There is a 33% reduction in Cmax and a 31% reduction in AUC0-∞ in participants with moderate hepatic impairment (Child-Pugh Class B) but without HBV infection when compared to participants with normal hepatic function.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “AUC0-∞ and Cmax were lower in participants with moderate HI (GMR 0.69 and 0.67, respectively) than in HPs, while apparent clearance (CL/F) and apparent terminal phase volume of distribution (Vz/F) were higher (GMR 1.44 and 1.64, respectively), but fell within the predefined thresholds of difference for this study.”
Source: [Noormohamed et al. (2024)](https://doi.org/10.1002/cpdd.1454)
##### 2.1.2.7 Contraindications/Warnings/Precautions/Adverse Effects
###### 2.1.2.7.1 Warnings and Precautions
###### Boxed warning: on-treatment hepatic flares
> “HIBSAGO may cause on-treatment hepatic flares with increases in ALT of >20-40x ULN associated with decline in HBsAg. Some cases were associated with hyperbilirubinemia. Most occurred in the first 12 weeks of treatment and resolved when treatment was interrupted or permanently discontinued”
> “ALT and total bilirubin must be measured prior to initiation of HIBSAGO and frequently monitored during treatment”
> “Interruption of treatment, followed by reducing the dose or discontinuation of HIBSAGO, may be necessary based on the results of liver laboratory tests”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Boxed warning: thrombocytopenia
> “HIBSAGO may cause reductions in platelet counts that may result in sudden and unpredictable thrombocytopenia, which can be life-threatening.”
> “Prior to starting HIBSAGO, obtain a platelet count to ensure the patient is eligible for treatment”
> “During treatment, monitor platelet counts weekly if values are 75 x 109/L or greater, and more frequently if values are less than 75 x 109/L”
> “If a patient develops signs or symptoms of thrombocytopenia, obtain a platelet count as soon as possible. The patient should not receive additional doses of HIBSAGO unless platelet counts return to 100 x 109/L or greater. If platelet count falls below 50 x 109/L, treatment with HIBSAGO should be permanently discontinued”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Contraindications: hepatic impairment, cirrhosis, and low platelet count
> “HIBSAGO is contraindicated in patients:”
> “with acute hepatic impairment, or cirrhosis who have mild, moderate, or severe hepatic impairment (Child-Pugh Class A, B, or C)”
> “with a platelet count below 100 x 109/L prior to initiation of treatment”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: on-treatment hepatic flares
> “During treatment with HIBSAGO, increases in ALT ≥3 x ULN to 69 x ULN were observed in clinical trials”
> “Most ALT increases occurred in the first 12 weeks of treatment (typically between Weeks 5 to 10), started to resolve within 2 weeks, and were not associated with any clinical signs or symptoms of liver dysfunction. The ALT increases were temporally associated with a preceding or concurrent decline in HBsAg suggesting host immune response. Two percent of participants receiving HIBSAGO had ALT increases ≥20 x ULN that resolved when treatment was interrupted or permanently discontinued.”
> “isolated cases of ALT increases associated with an increase in total bilirubin up to 4 x ULN that resolved when treatment was permanently discontinued.”
> “In all patients, the minimum recommended on-treatment monitoring of ALT and total bilirubin is weekly through Week 12 and every other week from Weeks 12 through 24, but more frequent monitoring may be necessary.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: thrombocytopenia
> “HIBSAGO may cause reductions in platelet count at any time during treatment that may result in sudden and unpredictable thrombocytopenia that can be life-threatening. In the HIBSAGO clinical trials, two participants reported serious adverse reactions of thrombocytopenia <50 × 10⁹/L, including one participant with immune thrombocytopenia”
> “In addition, a gradual, dose-dependent decline in platelet count was observed in most patients that continued to worsen while on HIBSAGO.”
> “In patients with platelet count below the normal range but ≥100 x 109/L, rule out cirrhosis before initiating HIBSAGO”
> “In all patients, the minimum recommended on-treatment monitoring of platelet counts is weekly through Week 24, but more frequent monitoring may be necessary.”
> “If platelet count falls below 50 x 109/L, permanently discontinue treatment with HIBSAGO and consider corticosteroid treatment in consultation with an expert.”
> “Consider the risks and benefits of treatment with HIBSAGO when treating patients who may be particularly susceptible to platelet count decreases, e.g., elderly patients, or patients with bleeding diathesis/coagulopathy, history of major bleeding events or patients taking antiplatelets, anticoagulants, or drugs that lower platelet count”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: worsening renal function
> “In the HIBSAGO clinical trials, mean eGFR declined within 4 weeks of initiation of HIBSAGO and continued to decline during treatment. These changes were generally reversible after treatment discontinuation. The mechanism of the decrease in eGFR is not clear”
> “Obtain eGFR and uACR in all patients prior to initiation of treatment.”
> “insufficient data are available on the safety of HIBSAGO in these populations”
> “In all patients, the minimum recommended on-treatment monitoring of eGFR is every other week through Week 24, but more frequent monitoring may be necessary.”
> “Although no cases of glomerulonephritis were observed with HIBSAGO administration in the clinical trials, glomerulonephritis has been observed after administration of other antisense oligonucleotides. Consider assessing for proteinuria periodically during treatment, as appropriate. If a diagnosis of glomerulonephritis is suspected or confirmed, permanently discontinue HIBSAGO and consider early initiation of immunosuppressive therapy in consultation with an expert.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: inflammatory and immune effects
> “In trials with HIBSAGO, influenza-like symptoms, laboratory test changes (e.g., decreases in complement factors C3 and C4), purpuric leg rashes, cutaneous leukocytoclastic vasculitis, dermatitis, pruritus/erythematous plaque, and polyarthralgia were observed. In addition, serious inflammatory and immune adverse reactions were reported, including immune thrombocytopenia, autoimmune hemolytic anemia, systemic inflammatory response syndrome, and a cryoglobulinemic flare”
> “Consider the risks and benefits of HIBSAGO when treating patients that may be more susceptible to inflammatory and/or immune effects, e.g., solid organ transplant recipients, patients with autoimmune hepatitis, or patients with a history of vasculitis or conditions associated with vasculitis (including systemic lupus erythematosus, cryoglobulinemia, or rheumatoid arthritis).”
> “If signs and symptoms suggestive of vasculitis/immune-associated events occur, and no alternative cause is identified, permanently discontinue treatment with HIBSAGO.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: serious adverse reaction with improper administration
> “Improper HIBSAGO administration, including not rotating injection sites, has been associated with the serious adverse reaction of omental infarction in one participant.”
> “A serious adverse reaction of omental infarction requiring surgical intervention occurred at Treatment Week 11 in a participant who had four weeks of persistent erythema at the HIBSAGO injection site and in whom injection sites had not been rotated.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: exacerbations of hepatitis B after nucleos(t)ide analog discontinuation
> “Severe acute exacerbations of HBV infection may occur after discontinuation of anti-HBV therapy. If NrtI therapy is discontinued after completing HIBSAGO treatment, frequent monitoring is recommended.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: HIV-1 virologic failure in HBV and HIV-1 coinfection
> “Patients who are taking nucleos(t)ide analog reverse transcriptase inhibitors as part of antiretroviral therapy for HIV-1 and HBV coinfection must not stop taking their nucleos(t)ide analog reverse transcriptase inhibitor therapy unless an HIV healthcare provider has directed them to do so.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: hepatitis flare in HBV and hepatitis D virus coinfection
> “There are no data on the safety and efficacy of HIBSAGO in patients with HBV and hepatitis D virus (HDV) coinfection. HIBSAGO is not recommended in patients with HDV coinfection due to the potential for an exacerbated risk of clinically significant ALT increases.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Warning: unknown effect on preventing transmission of HBV
> “There are no data on the effect of HIBSAGO in preventing transmission of HBV. Patients must be advised to use appropriate precautions to prevent transmission of HBV.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Safety population and discontinuations due to adverse events in B-Well 1 and B-Well 2
> “The safety of HIBSAGO in the treatment of chronic HBV infection has been evaluated in two pooled, Phase 3, placebo-controlled randomized trials (B-Well 1 and B-Well 2) in which 1,223 participants received at least one dose of HIBSAGO (300 mg subcutaneously, twice weekly during Weeks 1 and 2, and once weekly during Weeks 3 to 24) and 611 participants received matching placebo.”
> “In the pooled B-Well 1 and B-Well 2 trials, 3% of participants receiving HIBSAGO and <1% of participants receiving placebo discontinued due to adverse events.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Adverse reactions reported in at least 3% of participants in B-Well 1 and B-Well 2, weeks 1 to 36
| Adverse reaction (all grades) | Bepirovirsen, N = 1,223 | Placebo, N = 611 |
| --- | --- | --- |
| Injection site reactions (all types) | “57%” | “15%” |
| Pyrexia | “20%” | “4%” |
| Fatigue | “16%” | “8%” |
| Headache | “14%” | “12%” |
| Myalgia | “8%” | “4%” |
| Nausea or vomiting | “5%” | “3%” |
| Erythema | “5%” | “<1%” |
| Pruritus | “5%” | “2%” |
| Influenza-like illness | “4%” | “2%” |
| Rash | “3%” | “1%” |
| Contusion | “3%” | “1%” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Adverse reaction definitions and less common adverse reactions
> “Frequencies of adverse reactions are based on all adverse events, regardless of investigator assessment of causality, excluding laboratory abnormalities reported as adverse events”
> “Fatigue includes the preferred terms asthenia, fatigue, malaise, lethargy and sluggishness.”
> “The following adverse reactions occurred in <3% of participants receiving HIBSAGO and are included because of a potential causal relationship:”
> “Immune system disorders: Hypersensitivity”
> “Skin and soft tissue disorders: Angioedema”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Injection site reactions in B-Well 1 and B-Well 2, weeks 1 to 36
| Injection site reaction (all grades) | Bepirovirsen, N = 1,223 | Placebo, N = 611 |
| --- | --- | --- |
| Any injection site reaction | “57%” | “15%” |
| Injection site erythema | “32%” | “2%” |
| Injection site pain | “24%” | “6%” |
| Injection site pruritus | “19%” | “1%” |
| Injection site bruising | “19%” | “6%” |
| Injection site induration/swelling | “13%” | “1%” |
| Injection site discoloration | “8%” | “<1%” |
| Injection site rash | “6%” | “<1%” |
| Injection site hematoma | “4%” | “1%” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “ISRs were the most common adverse reactions reported with HIBSAGO.”
> “The frequency and severity of injection site reactions decreased over time, and 99% of injection site reactions reported in HIBSAGO recipients were mild to moderate in severity.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Cutaneous vasculitis: biopsy-confirmed cases
> “Adverse reactions of biopsy-confirmed vasculitis occurred in two participants treated with HIBSAGO.”
> “leukocytoclastic vasculitis, and the events resolved with corticosteroid treatment after permanent discontinuation of HIBSAGO”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Laboratory abnormalities worsened from baseline in B-Well 1 and B-Well 2, weeks 1 to 36
| Laboratory category | Bepirovirsen, N = 1,223 | Placebo, N = 611 |
| --- | --- | --- |
| ALT ≥3x to <5x ULN | “10%” | “<1%” |
| ALT ≥5x to <10x ULN | “8%” | “0” |
| ALT ≥10x to <20x ULN | “4%” | “0” |
| ALT ≥20x ULN | “2%” | “<1%” |
| AST ≥3x to <5x ULN | “6%” | “<1%” |
| AST ≥5x to <10x ULN | “4%” | “<1%” |
| AST ≥10x to <20x ULN | “1%” | “<1%” |
| AST ≥20x ULN | “<1%” | “0” |
| Total bilirubin ≥ULN to <1.5x ULN | “8%” | “11%” |
| Total bilirubin ≥1.5x to <2x ULN | “2%” | “2%” |
| Total bilirubin ≥2x ULN | “<1%” | “<1%” |
| Platelets ≥100 to <140 x 10^9/L | “37%” | “7%” |
| Platelets ≥75 to <100 x 10^9/L | “8%” | “<1%” |
| Platelets ≥50 to <75 x 10^9/L | “2%” | “<1%” |
| Platelets ≥25 to <50 x 10^9/L | “<1%” | “0” |
| Platelets <25 x 10^9/L | “<1%” | “0” |
| ANC ≥500 to <1,000 cells/mm3 | “8%” | “3%” |
| ANC ≥100 to <500 cells/mm3 | “1%” | “<1%” |
| ANC <100 cells/mm3 | “0” | “0” |
| eGFR ≥15 to <30% decline from baseline | “51%” | “30%” |
| eGFR ≥30 to <50% decline from baseline | “17%” | “6%” |
| eGFR ≥50% decline from baseline | “1%” | “<1%” |
| uACR ≥0.3 mg/mg | “2%” | “1%” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “Each participant is only counted once per parameter with the laboratory value that represents their largest change from baseline in Weeks 1-36.”
> “Information based on laboratory values reported from the central laboratory for B-Well 1 and B-Well 2 (local laboratory results were not included).”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Laboratory abnormalities: ALT increases leading to treatment pause or discontinuation
> “During the first 24 weeks, <1% (n = 1) of HIBSAGO recipients had ALT ≥3x ULN with bilirubin ≥2x ULN (>35% direct bilirubin) and permanently discontinued treatment”
> “Three other participants also permanently discontinued treatment because of ALT ≥10 x ULN for 4 or more weeks, and 53 (4%) paused treatment due to ALT increases.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Laboratory abnormalities: platelet count decreases
> “During the first 24 weeks, two participants treated with HIBSAGO had serious adverse reactions of thrombocytopenia, with platelet counts <50 × 10⁹/L.”
> “This participant was assessed as having immune thrombocytopenia. Both participants recovered with corticosteroid treatment and permanent discontinuation of HIBSAGO”
> “In total, 8 (<1%) participants met permanent discontinuation criteria, and 114 (9%) participants paused treatment due to platelet declines.”
> “In the pivotal clinical trials, the maximum change from baseline in platelet count in the HIBSAGO group occurred at Week 24, with a mean (SD) change from baseline of -68 x 109/L (40.7) or -28.1% (13.79), from a baseline of 233 x 109/L. The mean platelet count in the HIBSAGO group recovered to within 5% of baseline values by Week 60 (36 weeks after last dose of HIBSAGO).”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Laboratory abnormalities: neutrophil count decreases
> “During the first 24 weeks, 27 (2%) of participants had neutrophil counts <1,000 cells/mm3 at 2 or more consecutive visits. No participant had a value <500 cells/mm3 at 2 or more consecutive visits. The decline in neutrophil count was not associated with adverse events that indicated increased risk of infection.”
> “In the pivotal clinical trials, the maximum change from baseline in absolute neutrophil count in the HIBSAGO group occurred at Week 24, with a mean (SD) change from baseline of -0.795 x 109/L (1.0969) or -20.36% (29.40), from a baseline of 3.33 x 109/L.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Laboratory abnormalities: eGFR decreases
> “During the first 24 weeks, in participants treated with HIBSAGO, 4% had an eGFR decrease >30% of pretreatment levels for 2 or more consecutive readings and <1% (one participant) experienced such declines more than 24 weeks after completion of HIBSAGO treatment”
> “No participant met criteria for permanent discontinuation of HIBSAGO treatment based on decreased renal function, but 28 (2%) participants paused treatment because of decreased renal function.”
> “In the pivotal clinical trials, the maximum change from baseline in eGFR in the HIBSAGO group occurred at Week 25, with a mean (SD) change from baseline of -10 mL/min/1.73 m2 (9.96) or -10% (10.28), from a baseline of 100.8 mL/min/1.73m2. The mean eGFR in the HIBSAGO group recovered to within 5% of baseline values by Week 36 (12 weeks after last dose of HIBSAGO).”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Pooled adverse events, serious adverse events, and grade 3 or higher adverse events
> “In a pooled analysis at 72 weeks, adverse events were reported in 91% of the patients in the bepirovirsen groups and in 73% of those in the placebo groups; serious adverse events were reported in 7% and 4% of the patients, respectively. During the treatment period, adverse events of grade 3 or higher were reported in 16% of the patients who received bepirovirsen and in 3% of those who received placebo; increases in the alanine aminotransferase level were the most common grade 3 adverse events with bepirovirsen (in 6% of the patients).”
Source: [Hou et al. (2026a)](https://pubmed.ncbi.nlm.nih.gov/42206582/)
###### Immunogenicity: anti-drug antibodies
> “In the Phase 3 B-Well trials, 43% (517/1,203) of participants treated with HIBSAGO tested positive for ADAs. The presence of ADAs resulted in a 26.6% lower systemic clearance of bepirovirsen. The development of these antibodies did not appear to be associated with a reduced treatment response or differences in the safety profile.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Overdosage
> “Single doses of HIBSAGO 600 mg (2 times the recommended dose) were administered subcutaneously in a clinical trial to 5 healthy adults. Two participants developed tolerability issues at this dose, with symptoms including headache, nausea, vomiting, myalgia, and dizziness which lasted 24 to 48 hours despite symptomatic treatment.”
> “There is no specific treatment for an overdose with HIBSAGO. If overdose occurs, the patient should be treated supportively with appropriate monitoring.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
##### 2.1.2.8 Special Populations
###### Pregnancy
> “There are insufficient data on the use of HIBSAGO in pregnant women to evaluate for a drug-associated risk of major birth defects, miscarriage or other adverse maternal or fetal outcomes. In animal reproduction studies, no adverse developmental or reproductive effects were observed when bepirovirsen was administered subcutaneously to mice and rabbits at less than 1 (mouse) and approximately 3 (rabbits) times the maximum recommended human dose (MRHD), based on body surface area (BSA) comparisons (see Data).”
> “The estimated background risk of major birth defects and miscarriage for the indicated population is unknown.”
> “Reduced fetal weights associated with maternal toxicity were observed at approximately 3 times the MRHD based on BSA comparison.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Lactation
> “There are insufficient data on the presence of bepirovirsen or its metabolites in human milk, the effects on the breastfed infant, or the effects on milk production. Bepirovirsen was detectable in the milk of lactating mice without an effect on offspring (see Data). When a drug is present in animal milk, it is likely that the drug will be present in human milk.”
> “Although bepirovirsen was detected in the milk of lactating mice (on LD 10), systemic exposure of bepirovirsen in the offspring via milk was negligible.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Pediatric use: prescribing information
> “The safety and effectiveness of HIBSAGO have not been established in patients less than 18 years of age.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Pediatric development: European paediatric investigation plan
> “the paediatric population from birth to less than 2 years of age;”
> “Open label, randomised, controlled study of pharmacokinetics (PK), safety and efficacy of bepirovirsen in children from 2 years to less than 18 years of age with chronic hepatitis B virus (HBV) infection.”
> “By May 2034”
Source: [EMA paediatric investigation plan decision P/0254/2022 (2022)](https://www.ema.europa.eu/en/documents/pip-decision/p-254-2022-ema-decision-8-july-2022-agreement-paediatric-investigation-plan-granting-deferral-granting-waiver-bepirovirsen-emea-003082-pip01-21_en.pdf)
###### Geriatric use
> “Of the total number of patients who received treatment with HIBSAGO in the B-Well 1 and B-Well 2 trials, 128 (10%) were 65 years of age and older. The efficacy response was generally higher for age <65 versus that for age ≥65 years [see Clinical Studies (14)]. No overall differences in safety of HIBSAGO were observed between patients 65 years of age and older and younger adult patients, but greater sensitivity of some older individuals cannot be ruled out.”
> “In the B-Well 1 and B-Well 2 trials, 21 (1%) participants were 75 years of age and older. Differences in efficacy in this age group versus younger adult patients cannot be determined due to the small number of participants.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Renal impairment: dosing statement
> “No dosage adjustment is recommended in patients with mild renal impairment (eGFR 60 to 89 mL/min/1.73m2) [see Clinical Pharmacology (12.3)]. Insufficient data are available on the safety of HIBSAGO in patients with moderate or severe renal impairment or end stage renal disease (eGFR less than or equal to 59 mL/min/1.73m2). HIBSAGO can cause worsening renal function [see Warnings and Precautions (5.3)].”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Renal impairment: dedicated pharmacokinetic study
> “This is a 2-part study where all participants will receive bepirovirsen. The study will measure how much bepirovirsen from a single dose gets into the blood, and how long it stays in the blood. The purpose of the study is to understand if blood levels of bepirovirsen are different in adults with kidney disease compared to healthy adults who do not have kidney disease.”
Source: [ClinicalTrials.gov NCT07168356](https://clinicaltrials.gov/study/NCT07168356)
###### Hepatic impairment and cirrhosis
> “The safety and efficacy of HIBSAGO in patients with cirrhosis have not been established. The use of HIBSAGO is contraindicated in chronic hepatitis B patients with acute hepatic impairment, or cirrhosis who have mild, moderate, or severe hepatic impairment (Child-Pugh Class A, B, or C) [see Contraindications (4), Clinical Pharmacology (12.3)].”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “Moderate HI did not have a clinically relevant impact on bepirovirsen PK or safety.”
Source: [Noormohamed et al. (2024)](https://doi.org/10.1002/cpdd.1454)
###### Hepatitis C virus coinfection
> “The safety and efficacy of HIBSAGO have not been established in patients with hepatitis C virus (HCV) coinfection.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Hepatitis D virus coinfection
> “There are no data on the safety and efficacy of HIBSAGO in patients with HBV and hepatitis D virus (HDV) coinfection. HIBSAGO is not recommended in patients with HDV coinfection due to the potential for an exacerbated risk of clinically significant ALT increases.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### HIV-1 coinfection: continuation of nucleos(t)ide analogue therapy
> “Patients who are taking nucleos(t)ide analog reverse transcriptase inhibitors as part of antiretroviral therapy for HIV-1 and HBV coinfection must not stop taking their nucleos(t)ide analog reverse transcriptase inhibitor therapy unless an HIV healthcare provider has directed them to do so.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### HIV-1 coinfection: exclusion from the pivotal trials and an ongoing trial
> “Participants were excluded from the trial if they had a history, suspicion, or evidence of cirrhosis; co-infection with HCV, HIV, or HDV; history or evidence of potential vasculitis; eGFR ≤60 mL/min/1.73m2; or platelet count <140 x 109/L.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “This study will evaluate the efficacy and safety of bepirovirsen compared to placebo in participants with human immunodeficiency virus (HIV)/hepatitis B virus (HBV) co-infection.”
Source: [ClinicalTrials.gov NCT06497504](https://clinicaltrials.gov/study/NCT06497504)
##### 2.1.2.9 Drug/Drug, Drug/disease Interactions
###### 2.1.2.9.1 Effects of Other Drugs on Bepirovirsen
###### Drug interaction studies and nucleos(t)ide analogue coadministration: prescribing information
> “No formal clinical drug interaction studies have been conducted with HIBSAGO. In clinical trials, concomitant administration of HIBSAGO with a NrtI did not result in changes in bepirovirsen exposure.”
> “Based on in vitro study results, HIBSAGO is not a substrate, inducer or inhibitor of major cytochrome P450 (CYP) enzymes, or drug transporters; therefore, clinically relevant pharmacokinetic interactions are not expected.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Bepirovirsen exposure with and without entecavir or tenofovir: phase 2a study
| Group and study day | AUC0-24 (µg•h/mL), mean (SD) | AUCtau (µg•h/mL), mean (SD) | Cmax (µg/mL), mean (SD) | tmax (hour), mean (SD) |
| --- | --- | --- | --- | --- |
| Bepirovirsen 300 mg, day 1 (n = 12) | “134 (44.2)” | Not applicable | “10.6 (3.4)” | “4.0 (1.3)” |
| Bepirovirsen 300 mg, day 22 (n = 12) | “117 (34.9)” | “146 (34.7)” | “9.5 (3.1)” | “3.4 (0.9)” |
| Bepirovirsen 300 mg plus entecavir or tenofovir, day 1 (n = 5) | “123 (33.1)” | Not applicable | “9.7 (2.2)” | “4.1 (0.4)” |
| Bepirovirsen 300 mg plus entecavir or tenofovir, day 22 (n = 4) | “111 (54.3)” | “147 (38.0)” | “8.8 (4.7)” | “4.2 (1.2)” |
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### No effect of nucleos(t)ide analogues on bepirovirsen pharmacokinetics
> “Bepirovirsen plasma pharmacokinetic parameters and concentration–time profiles in patients with chronic HBV in the CS3 study (NCT02981602) were similar with or without ETV or TFV coadministration, indicating no effect of NA coadministration on bepirovirsen pharmacokinetics.”
> “Bepirovirsen was not an in vitro substrate of MRP2, OATP1B1, OATP1B3, OAT1, OAT3, OCT1, OCT2, MATE1, or MATE2‐K.”
> “Although reliable and meaningful efflux ratios could not be determined for P‐gp or BCRP, bepirovirsen is unlikely to be a substrate of P‐gp or BCRP efflux transporters.”
> “ASOs are not typically metabolized by CYP enzymes but are instead primarily metabolized by endonucleases and exonucleases or have been chemically modified to resist degradation.”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### Nucleos(t)ide analogue treatment status as a covariate in the population pharmacokinetic model
> “Results of this PK analysis suggest that no dose adjustment should be recommended for bepirovirsen based on demographic or baseline characteristics, or according to nucleos(t)ide analogue treatment status.”
Source: [Youssef et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11219612/)
###### Limitations of the drug interaction assessment
> “Second, only the most common NAs used to treat chronic HBV infection (ETV and TFV) 3 were evaluated as perpetrator and victim in this analysis.”
> “Third, the small sample size did not allow for any statistical comparison.”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### 2.1.2.9.2 Effects of Bepirovirsen on Other Drugs
###### Effect on nucleos(t)ide analogue exposure and on enzymes and transporters: prescribing information
> “In addition, HIBSAGO did not impact NrtI exposure.”
> “Based on in vitro study results, HIBSAGO is not a substrate, inducer or inhibitor of major cytochrome P450 (CYP) enzymes, or drug transporters; therefore, clinically relevant pharmacokinetic interactions are not expected.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Entecavir and tenofovir exposure during bepirovirsen coadministration: B-Clear
| Nucleos(t)ide analogue and data source | AUC0-24 (ng•h/mL) | Cmax (ng/mL) | Ctau (ng/mL) |
| --- | --- | --- | --- |
| Entecavir 0.5 mg once daily with bepirovirsen, B-Clear, mean ± SD | “24.4 ± 6.8” | “6.5 ± 2.3” | “0.5 ± 0.1” |
| Tenofovir disoproxil fumarate 245 or 300 mg once daily with bepirovirsen, B-Clear, mean ± SD | “2754 ± 661” | “319 ± 95.9” | “57.0 ± 17.1” |
| Tenofovir disoproxil fumarate 300 mg single dose, published, mean ± SD | “2290 ± 690” | “300 ± 90.0” | Not reported |
| Tenofovir alafenamide 25 mg once daily with bepirovirsen, B-Clear, mean ± SD | “308 ± 105” | “19.4 ± 5.9” | “10.3 ± 3.5” |
| Tenofovir alafenamide 25 mg once daily, product label, mean (CV %) | “400 (35.2)” | “30.0 (24.6)” | “10.0 (39.6)” |
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### No effect of bepirovirsen on entecavir or tenofovir pharmacokinetics
> “The analysis included 186 ETV plasma concentrations from 16 participants treated with bepirovirsen and ETV, 70 TFV plasma concentrations from 6 participants treated with bepirovirsen and TDF, and 70 TFV plasma concentrations from 5 participants treated with bepirovirsen and TAF. As summarized in Table 3, mean ETV and TFV Cmax and AUC values from participants in the B‐Clear study who received coadministration of bepirovirsen and NA (ETV, TDF, or TAF) were consistent with published data without coadministered bepirovirsen.”
> “Thus, the analyses reported here showed no potential for DDI between bepirovirsen and ETV or TFV, substantiated by both in vitro assessments and clinical evaluation. Based on the totality of data, bepirovirsen Phase 3 studies were permitted by health authorities to proceed without conducting dedicated DDI studies.”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### In vitro inhibition and induction of enzymes and transporters
> “Bepirovirsen was not a clinically relevant reversible or time‐dependent inhibitor of CYP1A2, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, or CYP3A4/5 or a reversible inhibitor of UGT enzymes.”
> “Bepirovirsen was an inducer of CYP3A4 in vitro in 1 of 3 cryopreserved human hepatocyte donors only, with unbound concentration causing half‐maximal induction effect and maximum induction effect values of 13.6 µM and 2.28‐fold, respectively (Table 1). The results of the basic static modeling indicate that bepirovirsen is not considered to be a CYP3A4 inducer of clinical DDI concern.”
> “Bepirovirsen inhibited the MRP2 transporter in vitro with an IC50,u of 8.49 µM. Results of the basic static model predicted that bepirovirsen is not a clinically relevant inhibitor of MRP2.”
> “The maximum unbound plasma concentration (Cmax), following the therapeutic subcutaneous dose of 300 mg, administered weekly for 24 weeks, was 57 nM.”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### Anticoagulants, antiplatelets, and drugs that decrease platelet count
> “Monitor patients for signs of bleeding and thrombocytopenia if HIBSAGO is taken concomitantly with anticoagulants, antiplatelets, or drugs that decrease platelet count [see Warnings and Precautions (5.2), Adverse Reactions (6.1)].”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Drugs that impair renal function
> “Monitor patients for signs of worsening renal function during concomitant administration of HIBSAGO with drugs that may impair renal function. Refer to individual drug information before prescribing [see Warnings and Precautions (5.3), Adverse Reactions (6.1)].”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Peginterferon alfa-2a
> “Concomitant administration of HIBSAGO and peginterferon alfa-2a is not recommended due to the potential for an exacerbated risk of increased ALT, decreased platelet count, and immune-mediated effects.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Drug-disease interaction: hepatitis D virus coinfection and ALT increases
> “HIBSAGO is not recommended in patients with HDV coinfection due to the potential for an exacerbated risk of clinically significant ALT increases.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
##### 2.1.2.10 Dosing and Administration
###### 2.1.2.10.1 Dosage
###### Recommended dosage: loading phase and maintenance phase
> “HIBSAGO is for subcutaneous use only”
> “Weeks 1 and 2”
> “The recommended dosage of HIBSAGO is 300 mg (administered as two 150 mg subcutaneous injections) twice a week allowing 3 or 4 days between each dose.”
> “Weeks 3 to 24”
> “The recommended dosage of HIBSAGO is 300 mg (administered as two 150 mg subcutaneous injections) once a week on the same day each week.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Treatment duration and early cessation at week 12
> “The maximum recommended duration of HIBSAGO treatment is 24 weeks”
> “Early cessation of HIBSAGO may be considered in patients who have not achieved HBsAg <1 IU/mL by Treatment Week 12”
> “Among participants with baseline HBsAg ≤3,000 IU/mL who met this criterion, 34% (203/601) had sustained suppression of HBV DNA and HBsAg not detected at 24 weeks after cessation of all chronic HBV treatment. Participants who did not meet this criterion (who had HBsAg ≥1 IU/mL at Week 12) had a 2% (9/498) probability of having sustained suppression of HBV DNA and HBsAg not detected at 24 weeks after cessation of all chronic HBV treatment.”
> “Among participants with baseline HBsAg ≤1,000 IU/mL who met this criterion, 42% (179/426) achieved this endpoint, and those who did not meet this criterion had a 2.5% (7/280) probability of achieving this endpoint.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Patient selection: quantitative HBsAg testing and baseline laboratory tests
> “Prior to initiation of HIBSAGO for treatment of chronic HBV infection, test all patients to quantify HBsAg levels in serum or plasma to identify patients with baseline HBsAg levels less than or equal to 3,000 IU/mL”
> “In addition, test patients for HBV DNA, ALT, AST, bilirubin, platelet count, urine albumin-creatinine ratio (uACR), and estimated glomerular filtration rate (eGFR) prior to initiation of treatment and as directed while on treatment and following treatment completion”
> “HIBSAGO therapy should be prescribed only when appropriate laboratory monitoring can be performed to manage the treatment regimen. Close laboratory monitoring is required to assess for toxicities that may necessitate dose modification, treatment interruption, or permanent discontinuation of HIBSAGO”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “The FDA also authorized the Roche Elecsys HBsAg II quant II RxDx assay as a companion diagnostic device to aid in the selection of patients with chronic HBV infection for treatment with antiviral therapy in accordance with the FDA approved drug labeling”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
> “Quantitative surface antigen testing will support the diagnosis and identification of patients suitable for treatment with bepirovirsen who have baseline HBsAg levels ≤3000 IU/ml. Several tests are available, including a recently authorised FDA test.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Dosage modification by ALT and total bilirubin
| ALT and total bilirubin | Dosage | ALT and total bilirubin monitoring frequency |
| --- | --- | --- |
| ALT <3x ULN | “No dosage adjustments required” | “Weekly through Week 12 and every other week from Weeks 12 through 24” |
| Total bilirubin <1.5x ULN, ALT <10x ULN | “No dosage adjustments required” | “Weekly through Week 12 and every other week from Weeks 12 through 24” |
| Total bilirubin <1.5x ULN, ALT ≥10x to <12x ULN | “No dosage adjustments required” | “Increase monitoring to twice weekly until ALT is on a downward trajectory” |
| Total bilirubin <1.5x ULN, ALT ≥12x ULN | “Pause treatment” “When ALT<10x ULN, resume treatment at 150 mg once a week. If ALT continues to decline, increase dosage to 300 mg once a week.” | “Increase monitoring to twice weekly until ALT is on a downward trajectory” |
| Total bilirubin <1.5x ULN, ALT ≥10x ULN for ≥4 weeks | “Permanently discontinue treatment” | “Twice weekly until ALT is on a downward trajectory and then as clinically indicated” |
| Total bilirubin ≥1.5 to <2x ULN, ALT ≥3x ULN | “Pause treatment” “When ALT <10x ULN and total bilirubin <1.5x ULN, resume treatment at 150 mg once a week. If ALT is on a downward trajectory, increase dosage to 300 mg once a week.” | “Increase monitoring to twice weekly until ALT is on a downward trajectory” |
| Total bilirubin ≥2x ULN, ALT ≥3x ULN | “Permanently discontinue treatment” | “Twice weekly until ALT is on a downward trajectory and then as clinically indicated” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “If ALT or total bilirubin has increased markedly from the previous assessment, repeat laboratory testing and review the results before giving the next dose of HIBSAGO, even if the values have not yet reached the thresholds that require treatment interruption or discontinuation.”
> “In all patients with abnormal values at the time of HIBSAGO discontinuation, obtain ALT and total bilirubin values at 4, 12, and 24 weeks post-treatment to assess recovery of ALT values to within the normal range, as appropriate.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Dosage modification by platelet count
| Platelet count (x 10^9/L) | Dosage | Platelet monitoring frequency |
| --- | --- | --- |
| ≥100 | “No dosage adjustment required” | “Weekly” |
| 75 to <100 | “Pause treatment” “When platelet count ≥100 x 109/L, resume treatment at 300 mg once a week” | “Weekly” |
| 50 to <75 | “Pause treatment” “When platelet count ≥100 x 109/L, resume treatment at 300 mg once a week” | “Every 2-3 days until 3 consecutive platelet counts ≥75 x 109/L” |
| 25 to <50 | “Permanently discontinue treatment” | “Every 2-3 days until 3 consecutive platelet counts ≥75 x 109/L” |
| <25 | “Permanently discontinue treatment” | “Daily until 2 consecutive platelet counts ≥25 x 109/L” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “If platelet count decreases by ≥30% between consecutive readings, repeat and review platelet count before administering further doses of HIBSAGO, even if platelet count is ≥100 x 109/L.”
> “In all patients with abnormal values at the time of HIBSAGO discontinuation, obtain repeat platelet counts 4 and 12 weeks post-treatment to assess for platelet count recovery, as appropriate.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Dosage modification by eGFR
| eGFR | Dosage | eGFR monitoring frequency |
| --- | --- | --- |
| No significant change from baseline | “No dosage adjustment required” | “Monitor eGFR every other week through Week 24” |
| Reduced by ≥30% from pretreatment levels for ≥2 consecutive readings | “Pause treatment” “When eGFR increases to within 15% of pretreatment levels, resume treatment at 300 mg once a week.” | “Monitor weekly until eGFR stabilizes or returns to pretreatment levels” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “In all patients with abnormal values at the time of HIBSAGO discontinuation, obtain eGFR at 4 weeks and 12 weeks post-treatment to monitor for renal function recovery, as appropriate.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Missed doses
> “If a dose of HIBSAGO is missed at any time during treatment (Weeks 1-24), the missed dose must be administered as soon as possible, unless the next scheduled dose is due in less than three days, in which case the missed dose must be skipped and the next dose administered as scheduled.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Completion of treatment: nucleos(t)ide analog continuation and criteria for stopping it
> “HIBSAGO must be stopped upon completion of 24 weeks of treatment, and patients must remain on their NrtI therapy for at least an additional 24 weeks. Following the 24 weeks of further NrtI treatment, stopping NrtI therapy can be considered in those patients who:”
> “are hepatitis B e-antigen (HBeAg) negative,”
> “have HBV DNA “do not need the nucleos(t)ide analog reverse transcriptase inhibitor therapy to treat Human Immunodeficiency Virus (HIV) co-infection”
> “If NrtI therapy is stopped, frequent monitoring of HBsAg, HBV DNA, and hepatic function is recommended for at least one year following NrtI therapy cessation, with routine monitoring as clinically indicated afterwards”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### 2.1.2.10.2 Administration
###### Route, supervised first dose, and self-administration
> “HIBSAGO must be administered under the guidance and supervision of a healthcare provider for the initial dose to ensure proper injection technique.”
> “Patients or caregivers may administer HIBSAGO after their healthcare provider determines that it is appropriate and with medical follow-up, including laboratory testing. Healthcare providers must provide proper training in subcutaneous injection technique before the patient or caregivers can administer HIBSAGO”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “Six-month treatment with option of self-administration after first dose”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Prefilled syringe and needle
> “Injection: 150 mg/mL of bepirovirsen as a clear, colorless to yellow sterile solution with no visible particulates in a single-dose prefilled glass syringe within a safety syringe device.”
> “HIBSAGO injection is supplied as two, 1-mL, single-dose, prefilled syringes with a 0.5 inch (12.7 mm), 27-gauge, stainless steel needle assembled with a needle guard.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Preparation before injection
> “Ensure HIBSAGO has been at room temperature (below 86°F [30°C]) for a minimum of 30 minutes prior to injection”
> “Prior to administration, visually inspect the window of the prefilled syringes for particulate matter or discoloration. HIBSAGO injection should be clear and colorless to yellow and free of visible particulate matter. Do not use HIBSAGO injection if the product exhibits discoloration, cloudiness, or particulate matter. Do not shake the HIBSAGO syringe. Do not use the syringes if they have been dropped or damaged.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Injection sites, two-syringe dose, and site rotation
> “Inject into the thigh or abdomen, avoiding the 2 inches (5 cm) around the navel. The outer area of the upper arm can also be used if a caregiver administers the subcutaneous injections.”
> “For a 300 mg dose, administer 2 x 150 mg pre-filled syringes, inject one right after the other. Choose a different injection site for each injection, at least 2 inches (5 cm) from the other injection sites”
> “For a 150 mg dose administer 1 x 150 mg pre-filled syringe injection.”
> “Never give injections into areas where the skin is tender, bruised, red, or hard. Rotate injection sites to reduce the risk of injection site reactions”
> “Ensure that injection sites are rotated from one week to the next and that the two injections administered weekly to constitute the recommended dose of HIBSAGO are separated by at least 2 inches (5 cm).”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Storage and handling after dispensing
> “Prior to Dispensing: Store in a refrigerator at 36°F to 46°F (2°C to 8°C). Do not freeze. Store in the original carton to protect from light. Do not shake.”
> “Following Dispensing: Store HIBSAGO at room temperature up to 86°F (30°C) for 12 weeks.”
> “Discard if the expiry date has passed, or it has been 12 weeks since carton was received, whichever comes first.”
> “HIBSAGO injection must be administered within 6 hours once removed from the carton. Discard if not administered within 6 hours.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Instructions for Use: preparation, injection, and disposal steps
> “Make sure HIBSAGO has been at room temperature up to 86°F (30°C) for at least 30 minutes before using it. Cold medicine is more painful to inject.”
> “If you are giving yourself the injection, you can inject into your thighs or stomach (abdomen).”
> “A caregiver can inject into the upper arm, thigh, or abdomen.”
> “Do not inject yourself in the upper arm.”
> “Inject within 5 minutes after you remove the gray needle cap.”
> “Hold the middle of the syringe and insert the entire needle into the pinched skin at a 45-degree angle using a dart like motion, as shown.”
> “Make sure the white plunger is pushed all the way down until the stopper reaches the bottom of the syringe and all of the medicine is injected.”
> “For a 300 mg dose, give your second injection immediately, to complete your dose, by repeating all Inject steps (Steps B1 through B5).”
> “Put your used HIBSAGO syringe(s) and gray needle cap(s) in an FDA-cleared sharps disposal container right away.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Patient counseling on administration technique
> “Train patients and caregivers on the importance of proper subcutaneous administration technique, the necessity of rotating injection sites and how to use the prefilled syringe. Instruct patients and/or caregivers to read and follow the Instructions for Use each time they use HIBSAGO”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Self-administration with the prefilled syringe: relative bioavailability study
> “Participants (N = 159) received a single 300 mg SC dose of bepirovirsen administered by a HCP (vial [n = 46] or PFS SSD [n = 49]), or self‐administered (PFS SSD, with [n = 32] or without [n = 32] training from a HCP).”
> “The GMR (90% CI) with participant training (Group 2 versus Group 3) was 1.02 (0.88, 1.18) for Cmax and 0.98 (0.88, 1.09) for AUC(0‐inf), and without participant training (Group 2 versus Group 4) was 0.99 (0.87, 1.13) for Cmax and 0.97 (0.87, 1.08) for AUC(0‐inf).”
> “The proportion of participants experiencing injection site reactions was higher when PFS SSD was self‐administered (Group 3: 32/32 [100%], Group 4: 30/32 [94%]) compared with HCP administration (Group 2: 43/49 [88%]).”
> “While 6 participants received an incomplete dose of bepirovirsen, owing to incorrect use of the PFS (4 of them injected approximately 75% to 95% of the dose), device usability was evaluated in separate formative and summative human factors studies, and the device and instructions for use were successfully validated for self‐administration (unpublished data).”
Source: [Youssef et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12856967/)
###### Injection site and exposure
> “Bepirovirsen exposure differed by SC injection site, with lower exposure observed when the SC injection was administered in the thigh compared with the abdomen or upper arm.”
Source: [Youssef et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12856967/)
##### 2.1.2.11 Access and Distribution
###### Access and patient support programs named at approval
> “The company will also be leveraging access and patient support programs to assist with Hibsago’s U.S. rollout.”
Source: [Fierce Pharma (2026)](https://www.fiercepharma.com/pharma/gsk-brings-promise-functional-cure-hepatitis-b-finish-line-fda-nod-hibsago)
###### Specialty pharmacy or distribution network
No evidence found.
###### Company contact and product website named in the labeling
> “To report SUSPECTED ADVERSE REACTIONS, contact GlaxoSmithKline at 1-888-825-5249 or FDA at 1-800-FDA-1088 or www.fda.gov/medwatch.”
> “For more information about HIBSAGO, call 1-888-825-5249 or visit our website at www.hibsago.com.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Care setting: laboratory monitoring and first dose under healthcare provider supervision
> “HIBSAGO therapy should be prescribed only when appropriate laboratory monitoring can be performed to manage the treatment regimen.”
> “HIBSAGO must be administered under the guidance and supervision of a healthcare provider for the initial dose to ensure proper injection technique.”
> “Patients or caregivers may administer HIBSAGO after their healthcare provider determines that it is appropriate and with medical follow-up, including laboratory testing.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “Six-month treatment with option of self-administration after first dose”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Companion diagnostic for patient selection
> “The FDA also authorized the Roche Elecsys HBsAg II quant II RxDx assay as a companion diagnostic device to aid in the selection of patients with chronic HBV infection for treatment with antiviral therapy in accordance with the FDA approved drug labeling and to assist in monitoring patients throughout the course of treatment.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
> “Quantitative surface antigen testing will support the diagnosis and identification of patients suitable for treatment with bepirovirsen who have baseline HBsAg levels ≤3000 IU/ml. Several tests are available, including a recently authorised FDA test.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Distribution in mainland China: collaboration with SBP Group
> “GSK plc (LSE/NYSE: GSK) today announced that it has entered into an exclusive strategic collaboration with Sino Biopharmaceutical, (SBP Group), through its subsidiary Chia Tai Tianqing Pharmaceutical Group Co., Ltd. (CTTQ), to accelerate bepirovirsen in mainland China at launch.”
> “Under the agreement, CTTQ will be responsible for importation, distribution, hospital access, and promotional and non-promotional activities for bepirovirsen in mainland China. GSK will remain the marketing authorisation holder and retain responsibility for regulatory, quality, pharmacovigilance and global medical strategy.”
> “Under the terms of the agreement, CTTQ will purchase bepirovirsen from GSK under agreed supply terms for an initial term of 5.5 years.”
> “Collaboration provides scaled access to over 5,000 medical centres in China at launch”
Source: [GSK press release, SBP Group collaboration (2026)](https://www.gsk.com/en-gb/media/press-releases/gsk-enters-exclusive-collaboration-with-sbp-group-a-market-leader-in-hepatology-in-china-to-accelerate-bepirovirsen-at-launch/)
##### 2.1.2.12 Co-prescribed/Concomitant Therapies
###### Required nucleos(t)ide analog reverse transcriptase inhibitor therapy
> “HIBSAGO is administered by subcutaneous injection and must be used in combination with NrtI therapy.”
> “HIBSAGO must be used in combination with NrtI therapy. Refer to the NrtI prescribing information for additional information.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Nucleos(t)ide analog therapy in B-Well 1 and B-Well 2: continuation, cessation, and restart
> “were receiving stable NrtI therapy (defined as no changes due to loss of virologic control for ≥6 months before the start of the trial and no plans for changes over the duration of the trial)”
> “From Week 25 to 48, participants continued to receive their NrtI therapy without HIBSAGO or placebo.”
> “At Week 48, participants who met the prespecified NrtI cessation eligibility criteria discontinued NrtI therapy.”
> “Through Week 96, among the 84 HIBSAGO recipients who discontinued NrtI therapy but did not achieve the primary endpoint at Week 72 (62 participants) or who achieved the primary endpoint but did not maintain a sustained response at Week 96 (22 participants), one participant met criteria to restart NrtI therapy. Protocol-defined criteria to restart NrtI therapy included HBV DNA >20,000 IU/mL at a single visit, HBV DNA >2,000 IU/mL at two sequential visits, confirmed HBeAg reversion, or clinical/hepatic decompensation. Out of the 84 participants, three additional participants restarted NrtI therapy within one month of NrtI cessation without having met the protocol-defined NrtI restart criteria.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “Participants who have documented chronic HBV infection ≥6 months prior to screening and currently receiving stable NA therapy defined as no changes to their NA regimen from at least 6 months prior to Screening and with no planned changes to the stable regimen over the duration of the study.”
> “Participants who are willing and able to cease their NA treatment in accordance with the protocol.”
Source: [ClinicalTrials.gov NCT05630807](https://clinicaltrials.gov/study/NCT05630807); [ClinicalTrials.gov NCT05630820](https://clinicaltrials.gov/study/NCT05630820)
###### Nucleos(t)ide analogs used with bepirovirsen in clinical trials: entecavir and tenofovir
> “Entecavir (ETV) and tenofovir (TFV) are the most commonly used NAs”
> “NAs such as lamivudine and adefovir were used in only 4 of 227 (1.8%) On‐NA participants in B‐Clear.”
> “the NCA PK parameters from 5 subjects receiving TAF in the B‐Clear study were similar to the published data on TAF (Table 3).”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### Nucleos(t)ide analog therapy at baseline in B-Together
| Current NA therapy | Arm 1 (bepirovirsen 24 weeks), n (%) | Arm 2 (bepirovirsen 12 weeks), n (%) | Total, n (%) |
| --- | --- | --- | --- |
| TAF or TDF | “33 (61)” | “37 (70)” | “70 (65)” |
| Entecavir | “19 (35)” | “12 (23)” | “31 (29)” |
| Other | “2 (4)” | “4 (8)” | “6 (6)” |
Source: [Buti et al. (2025)](https://doi.org/10.1016/j.jhep.2024.08.010)
> “Other NA medications included tenofovir, tenofovir disoproxil, lamivudine or tenofovir alafenamide.”
> “currently receiving stable NA therapy (defined as no changes to their NA regimen from at least 6 months prior to screening and with no planned changes to the stable regimen over the duration of the study) except telbivudine.”
Source: [Buti et al. (2025)](https://doi.org/10.1016/j.jhep.2024.08.010)
###### Pharmacokinetic interaction with entecavir and tenofovir
> “Bepirovirsen plasma pharmacokinetic parameters and concentration–time profiles in patients with chronic HBV in the CS3 study (NCT02981602) were similar with or without ETV or TFV coadministration, indicating no effect of NA coadministration on bepirovirsen pharmacokinetics.”
> “In patients with chronic HBV receiving both bepirovirsen and ETV or TFV in the B‐Clear study (NCT04449029), NA plasma concentrations and pharmacokinetic parameters were similar to those published without bepirovirsen coadministration, suggesting no effect of bepirovirsen coadministration on NA pharmacokinetics.”
Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/)
###### Antiviral activity in combination with entecavir or tenofovir and cross-resistance
> “Combining bepirovirsen with entecavir or tenofovir disoproxil fumarate in HepG2.2.15 cells (HBV genotype D, transfection-based delivery) resulted in no antagonism and greater reductions of intracellular HBV DNA by qPCR compared to the individual drugs.”
> “Cross-resistance between bepirovirsen and NrtIs including entecavir and tenofovir is not expected.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Peginterferon alfa-2a: concomitant use not recommended
> “Concomitant administration of HIBSAGO and peginterferon alfa-2a is not recommended due to the potential for an exacerbated risk of increased ALT, decreased platelet count, and immune-mediated effects.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Antiretroviral therapy in HIV and HBV coinfection
> “Advise patients living with HIV who are taking NrtI therapy for both HIV and HBV to not discontinue NrtI therapy except under the direct supervision of an HIV healthcare provider”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “Must be on uninterrupted antiretroviral therapy (ART) containing at least tenofovir disoproxil (TDF) or tenofovir alafenamide (TAF) plus lamivudine (3TC) or emtricitabine (FTC)”
Source: [ClinicalTrials.gov NCT06497504](https://clinicaltrials.gov/study/NCT06497504)
###### Concomitant medications restricted in B-Well 1 and B-Well 2
> “Currently taking, or took within 3 months of screening, any immunosuppressing drugs (e.g., prednisone), other than a short course of therapy (≤2 weeks) or topical/inhaled steroid use.”
> “Currently taking, or has taken within 12 months of Screening, any interferon containing therapy.”
> “Participants requiring anti coagulation therapies (e.g., warfarin, Factor Xa inhibitors) or anti-platelet agents (like clopidogrel or aspirin) unless treatment can safely be discontinued throughout duration of the study, by the discretion of the investigator. Occasional use is permitted.”
> “Prior treatment with any oligonucleotide or siRNA within 12 months prior to the first dosing day.”
Source: [ClinicalTrials.gov NCT05630807](https://clinicaltrials.gov/study/NCT05630807); [ClinicalTrials.gov NCT05630820](https://clinicaltrials.gov/study/NCT05630820)
##### 2.1.2.13 Effect of Bepirovirsen on Quality Measures
###### Medicaid Adult Core Set: Evaluation of Hepatitis B and C measure added for 2027
> “The following measures are being added to the 2027 Adult Core Set for voluntary state reporting”
> “This measure assesses the number and percentage of adult, non-dually eligible Medicaid beneficiaries who were tested for hepatitis B, tested for hepatitis C, and treated for hepatitis C. Timely testing, diagnosis, and treatment of hepatitis can prevent serious liver damage and improve outcomes.”
> “Measure Steward: Medicaid Outcomes Distributed Research Network’s (MODRN) Data Coordinating Center at the University of Pittsburgh”
Source: [CMS (2025)](https://www.medicaid.gov/federal-policy-guidance/downloads/sho25005.pdf)
###### Evaluation of Hepatitis B and C measure: listing in the 2027 Adult Core Set
| Field | 2027 Adult Core Set |
| --- | --- |
| Reporting category | “2027 Voluntary Adult Core Set Measures” |
| Domain | “Primary Care Access and Preventive Care” |
| CMIT number | “1852” |
| Measure steward | “MODRN” |
| Measure name | “Evaluation of Hepatitis B and C (EHBC-AD)” |
| Data collection method | “Administrative” |
| Status | “This measure was added to the 2027 Adult Core Set.” |
Source: [CMS 2027 Adult Core Set](https://www.medicaid.gov/medicaid/quality-of-care/downloads/2027-adult-core-set.pdf)
###### Evaluation of Hepatitis B and C measure: reported rates, populations, and testing results
> “Nine rates are reported for this measure across three populations: all adults, adults diagnosed with opioid use disorder (OUD), and pregnant women.”
> “The individual who suggested this measure said it is not currently in use by any state Medicaid or CHIP programs but was tested in seven state Medicaid programs”
> “They noted that measure testing results showed that hepatitis screening and treatment rates are low”
> “a Workgroup member said this is a testing measure rather than a screening measure and is not intended to capture everyone. They added that hepatitis B testing rates were low across states where the measure was tested, highlighting an opportunity to develop targeted testing strategies.”
Source: [Mathematica (2025)](https://www.mathematica.org/-/media/internet/features/2025/child-and-adult-core-set/2027coresetreview-finalreport_updated.pdf)
###### Viral hepatitis quality measures with a hepatitis B component in federal and commercial programs
| Measure | Brief description | Identifier | Steward | Programs using the measure |
| --- | --- | --- | --- | --- |
| Evaluation of Hepatitis B and C (EHBC-AD) | “Assess the number and percentage of adult, non-dually eligible Medicaid beneficiaries who were tested for hepatitis B, tested for hepatitis C, and treated for hepatitis C.” | “CMIT: 1852” | “MODRN” | “Medicaid Adult Core Set (2027)” |
| Adult Immunization Status | “Percentage of patients 19 years of age and older who are up-to-date on recommended routine vaccines for influenza; tetanus and diphtheria (Td) or tetanus, diphtheria and acellular pertussis (Tdap); zoster; pneumococcal; and hepatitis B.” | “MIPS: 493” “CMIT: 26” | “NCQA” | “MIPS Program” “Medicaid Adult Core Set” “HEDIS” “QHP QRS” |
Source: [CDC guidelines and quality measures (2026)](https://www.cdc.gov/high-quality-care/hcp/guidelines-quality-measures.html)
###### Healthy People 2030 objective IID-13: awareness of chronic hepatitis B infection
| Field | Objective record |
| --- | --- |
| Objective | “Increase the proportion of persons aware they have chronic hepatitis B” |
| National baseline | “32.4 percent of persons with chronic hepatitis B were aware they have chronic hepatitis B in 2013-16” |
| National target | “90.0 percent” |
| National status | “Baseline only” |
| Data source | “National Health and Nutrition Examination Survey (NHANES), CDC/NCHS” |
Source: [ODPHP Healthy People 2030 IID-13](https://odphp.health.gov/healthypeople/objectives-and-data/browse-objectives/infectious-disease/increase-proportion-people-who-know-they-have-chronic-hepatitis-b-iid-13)
###### Healthy People 2030 objective IID-15: deaths with hepatitis B as a cause
| Field | Objective record |
| --- | --- |
| Objective | “Reduce the rate of deaths with hepatitis B as the underlying or a contributing cause” |
| National baseline | “0.46 deaths with hepatitis B as the underlying or contributing cause of death per 100,000 population were reported in 2017” |
| Most recent data | “0.40 deaths with hepatitis B as the underlying or contributing cause of death per 100,000 population (2024)” |
| National target | “0.16 per 100,000” |
| National status | “Improving” |
Source: [ODPHP Healthy People 2030 IID-15](https://odphp.health.gov/healthypeople/objectives-and-data/browse-objectives/infectious-disease/reduce-rate-deaths-hepatitis-b-cause-iid-15)
###### Viral Hepatitis National Strategic Plan: hepatitis B core indicators and targets
| Core indicator | Measure | Baseline | 2025 target | 2030 target |
| --- | --- | --- | --- | --- |
| “Reduce acute hepatitis B infections” | “Estimated number of cases” | “22,200” | “18,000” | “2,200” |
| “Increase proportion of people with hepatitis B infection aware of their infection” | “Rate/100,000” | “32 (2013–2016 baseline)” | “50” | “90” |
| “Reduce rate of hepatitis B–related deaths” | “Rate/100,000” | “0.46” | “0.37” | “0.16” |
Source: [HHS Viral Hepatitis National Strategic Plan (2020)](https://www.hhs.gov/sites/default/files/Viral-Hepatitis-National-Strategic-Plan-2021-2025.pdf)
###### CDC universal hepatitis B screening recommendation and national awareness goal
> “HBV screening at least once during a lifetime for adults aged ≥18 years (new recommendation)”
> “calls for an increase in the proportion of persons with HBV infection who are aware of their infection from 32% (2013–2016) to 90% by 2030”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
###### Product-specific effect on quality measures
No evidence found.
##### 2.1.2.14 Product comparison
###### Bepirovirsen: class, labeled regimen, and adverse reactions
| Attribute | Prescribing information |
| --- | --- |
| Class | “Bepirovirsen is a synthetic, single-stranded, chimeric antisense oligonucleotide (ASO) with a gapmer architecture” |
| Combination requirement | “HIBSAGO must be used in combination with NrtI therapy.” |
| Dosage, weeks 1 and 2 | “The recommended dosage of HIBSAGO is 300 mg (administered as two 150 mg subcutaneous injections) twice a week allowing 3 or 4 days between each dose.” |
| Dosage, weeks 3 to 24 | “The recommended dosage of HIBSAGO is 300 mg (administered as two 150 mg subcutaneous injections) once a week on the same day each week.” |
| Maximum duration | “The maximum recommended duration of HIBSAGO treatment is 24 weeks” |
| Most common adverse reactions | “The most common adverse reactions (≥10%), excluding laboratory abnormalities, reported with HIBSAGO included injection site reactions, pyrexia, fatigue, and headache.” |
| Discontinuation due to adverse events | “In the pooled B-Well 1 and B-Well 2 trials, 3% of participants receiving HIBSAGO and <1% of participants receiving placebo discontinued due to adverse events.” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Bepirovirsen against nucleos(t)ide analogue standard of care: functional cure rates
> “The approval was supported by results from the B-WELL phase III trials showing functional cure rates of 19% in adults with ≤3000 IU/ml HBsAg, compared to current standard of care alone, which typically achieves less than 1% functional cure rate after one year of treatment.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
> “a functional cure rate of 26% (200 of 768 vs. 0 of 393 in the placebo group, with p<0.001 in both trials) was achieved in participants with ≤1000 IU/ml HBsAg level”
> “The current standard of care typically requires lifelong therapy, with functional cure rates achieved in less than 1% of patients.”
Source: [GSK press release, B-Well results (2026)](https://www.gsk.com/en-gb/media/press-releases/bepirovirsen-achieves-unprecedented-functional-cure-rates-with-potential-to-redefine-treatment-for-chronic-hepatitis-b/)
###### Bepirovirsen against placebo added to continued nucleos(t)ide analogue therapy: B-Well 1 and B-Well 2
> “All the patients were receiving stable nucleoside or nucleotide analogue (NA) therapy and had an HBsAg level of more than 100 to 3000 IU per milliliter.”
> “The percentage of patients with a functional cure at week 72 was significantly higher with bepirovirsen than with placebo both in the B-Well 1 trial (in 127 of 650 patients [20%] vs. none of 328 patients) and in the B-Well 2 trial (in 106 of 570 patients [19%] vs. none of 286 patients).”
Source: [Hou et al. (2026a)](https://pubmed.ncbi.nlm.nih.gov/42206582/)
###### Approved therapies: HBsAg loss rates cited in reports of investigational agents
> “NAs effectively suppress HBV DNA but rarely achieve HBsAg loss (0–3% after long-term NA therapy), while IFN therapy is limited by safety and tolerability concerns”
> “Bepirovirsen has shown sustained HBsAg loss in approximately 9–10% of participants after 24 weeks of finite treatment”
Source: [Wang et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13518476/)
> “PEG-IFNα offers a finite-duration treatment with modest functional cure (<10%)”
Source: [Wong et al. (2026a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12823419/)
###### RNA-targeting agents in clinical development: dosing, common adverse events, and phase
| Agent | Class | Dosing | Common adverse events | Clinical trial number | Phase |
| --- | --- | --- | --- | --- | --- |
| Imdusiran (AB-729) | siRNA | “60 mg or 90 mg at varying dosing intervals (4-weekly, 8-weekly, 12-weekly) for 48 weeks” | “Injection-site reaction” | “NCT06154278” | “Phase II” |
| Xalnesiran (RG-6346) | siRNA | “Ascending dosing (1.5–6.0 mg/kg) monthly for 4 months” | “Injection-site reaction, headache” | “NCT03772249” | “Phase II” |
| Daplusiran/tomligisiran (GSK5637608, formerly JNJ-3989) | siRNA | “Ascending dosing (25–400 mg) with varying dosing intervals (weekly, 2-weekly, 4-weekly) for 3 doses” | “Injection-site reaction, nasopharyngitis, malaise” | “NCT03365947” | “Phase II” |
| Elebsiran (VIR-2218) | siRNA | “200 mg monthly for 6 months” | “Injection-site reaction, headache” | “NCT02826018 and NCT03672188” | “Phase II” |
| RBD-1016 | siRNA | “Ascending dosing (0.3–3.0 mg/kg) at days 1 and 29” | “Injection-site reaction, headache” | “NCT05961098” | “Phase II” |
| Bepirovirsen | ASO | “300 mg or 150 mg weekly with loading dose for up to 24 weeks” | “Injection-site reaction, flu-like symptoms” | “NCT05630820” | “Phase III” |
Source: [Hui et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11750937/)
> “Dosing in latest clinical trials at the time of writing”
> “Common adverse events reported in latest clinical trials at the time of writing”
Source: [Hui et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11750937/)
###### Combination regimens with RNA-targeting agents in clinical development
| Combination | Clinical trial number | Phase |
| --- | --- | --- |
| “Imdusiran (siRNA) + Peg-IFNα” | “NCT04980482” | “Phase II” |
| “Elebsiran (siRNA) + Peg-IFNα” | “NCT04412863” | “Phase II” |
| “Bepirovirsen (ASO) + Peg-IFNα” | “NCT04676724” | “Phase II” |
| “Xalnesiran (siRNA) + ruzotolimod (Toll-like receptor 7 agonist) or Peg-IFNα” | “NCT04225715” | “Phase II” |
| “Daplusiran/tomligisiran (siRNA) + JNJ-6379 (Capsid assembly modulator)” | “NCT03982186 and NCT04129554” | “Phase II” |
| “Elebsiran (siRNA) + tobevibart (monoclonal antibody)” | “NCT04856085” | “Phase II” |
Source: [Hui et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11750937/)
###### Bepirovirsen compared with siRNAs and a GalNAc-conjugated antisense oligonucleotide: mechanism and development stage
> “Bepirovirsen is an unconjugated 20-mer ASO with a class II CpG motif that targets a conserved region in the HBV genome. Aside from its primary effect through complementary nucleotide binding, bepirovirsen can mediate TLR activity”
> “Bepirovirsen is now the only HBV RNAi therapeutic that has progressed to phase III clinical trials.”
> “The efficacy of GSK3389404 was weaker than that of bepirovirsen.”
> “The above trials demonstrated that single-agent siRNAs or ASOs cannot induce a high rate of functional cure in all patients.”
Source: [Hui et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11750937/)
###### Xalnesiran with or without an immunomodulator (Piranga phase 2): HBsAg loss 24 weeks after end of treatment
> “We conducted a phase 2, multicenter, randomized, controlled, adaptive, open-label platform trial that included the evaluation of 48 weeks of treatment with xalnesiran at a dose of 100 mg (group 1), xalnesiran at a dose of 200 mg (group 2), xalnesiran at a dose of 200 mg plus 150 mg of ruzotolimod (group 3), xalnesiran at a dose of 200 mg plus 180 μg of pegylated interferon alfa-2a (group 4), or a nucleoside or nucleotide analogue (NA) alone (group 5)”
> “Among 159 participants (30, 30, 34, 30, and 35 in groups 1 through 5, respectively), the primary end-point event occurred in 7% (95% confidence interval [CI], 1 to 22) of those in group 1, in 3% (95% CI, 0 to 17) of those in group 2, in 12% (95% CI, 3 to 28) of those in group 3, in 23% (95% CI, 10 to 42) of those in group 4, and in none (95% CI, 0 to 10) of those in group 5.”
> “HBsAg loss with or without seroconversion occurred only in participants with a screening HBsAg level below 1000 IU per milliliter.”
Source: [Hou et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/39774313/)
###### Xalnesiran with or without an immunomodulator (Piranga phase 2): grade 3 or 4 adverse events
> “In groups 1 through 5, respectively, grade 3 or 4 adverse events occurred in 17%, 10%, 18%, 50%, and 6% of the participants, with the most frequent event being an elevated alanine aminotransferase level.”
Source: [Hou et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/39774313/)
###### Xalnesiran-based regimens (Piranga phase 2): outcomes after nucleos(t)ide analogue discontinuation
> “Among 121 participants, 58 (48%) met NA stopping criteria and 40 (33%) discontinued NA.”
> “Among participants who remained off NA, five achieved and maintained HBsAg loss (HBsAg <0.05 IU/ml) and HBV DNA undetectable (HBV DNA <10 IU/ml); all were in treatment arms with an immunomodulator.”
> “Of the 40 participants who discontinued NA, 19 (48%) experienced virological relapse (VR), three (8%) of whom further developed clinical relapse.”
Source: [Cheng et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13594892/)
###### Elebsiran with pegylated interferon alfa against pegylated interferon alfa alone (ENSURE phase 2): HBsAg loss
> “In part I (cohorts 1–3), virally suppressed participants with chronic HBV infection naive to BRII-179 were randomized 1:1:1 to receive 48 weekly doses of PEG-IFNα alone or in combination with 13 doses of elebsiran (200 mg or 100 mg) administered every 4 weeks.”
> “In part I, at 24 weeks post-EOT, HBsAg loss was observed in 4 out of 19 (21.1%) participants receiving elebsiran 200 mg plus PEG-IFNα, 6 out of 18 (33.3%) participants receiving elebsiran 100 mg plus PEG-IFNα and 1 out of 18 (5.6%) participants receiving PEG-IFNα monotherapy.”
> “In part II, HBsAg loss was observed in 9 out of 31 (29.0%) participants at 24 weeks post-EOT, with a higher response among BRII-179 anti-HBs responders (8 out of 19 participants, 42.1%) compared with nonresponders (1 out of 12 participants, 8.3%).”
Source: [Wong et al. (2026a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12823419/)
###### Elebsiran with pegylated interferon alfa against pegylated interferon alfa alone (ENSURE phase 2): adverse events
| Event | PEG-IFNα alone (cohort 1, N = 18) | Elebsiran 200 mg plus PEG-IFNα (cohort 2, N = 19) | Elebsiran 100 mg plus PEG-IFNα (cohort 3, N = 18) |
| --- | --- | --- | --- |
| Grade 3 adverse events, n (%) | “6 (33.3)” | “6 (31.6)” | “5 (27.8)” |
| Grade 4 adverse events, n (%) | “2 (11.1)” | “0” | “1 (5.6)” |
| Serious adverse events, n (%) | “2 (11.1)” | “1 (5.3)” | “0” |
Source: [Wong et al. (2026a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12823419/)
> “ALT increases of grade 3 were observed in 2 of 19 (10.5%) of cohort 2 and 5.6% (1 of 18) of cohort 3 participants”
Source: [Wong et al. (2026a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12823419/)
###### Elebsiran with or without pegylated interferon alfa-2a (phase 2): HBsAg seroclearance and ALT elevations
> “Between July 2, 2020, and Nov 2, 2021, 124 individuals were screened for eligibility, 84 of whom were enrolled (15 in cohort 1, 15 in cohort 2, 18 in cohort 3, 18 in cohort 4, 13 in cohort 5, and five in cohort 6).”
> “Six participants (one in cohort 2, three in cohort 4, and two in cohort 5) had sustained HBsAg seroclearance through to 24 weeks after the end of treatment. No participants receiving VIR-2218 monotherapy (cohort 1) or VIR-2218 plus pegylated interferon-alfa-2a 12-week regimen (cohort 6) had HBsAg seroclearance.”
> “Two (13%) participants in cohort 1 had elevations in alanine aminotransferase, compared with 13 (87%) participants in cohort 2, 15 (83%) in cohort 3, 17 (94%) in cohort 4, 11 (85%) in cohort 5, and three (60%) in cohort 6.”
Source: [Yuen et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/39389081/)
###### Tobevibart with elebsiran, with or without pegylated interferon alfa (MARCH Part B): HBsAg loss and functional cure
> “Tobevibart was administered at 300 mg every 4 weeks; elebsiran, at 200 mg every 4 weeks”
> “Tobevibart and elebsiran without or with PEG-IFNα resulted in HBsAg loss 24 weeks post-end of treatment in 17% (3/18) and 21% (3/14) of participants with baseline HBsAg<1,000 IU/mL, respectively. These proportions were 8% (4/51) and 16% (5/32) for tobevibart and elebsiran without or with PEG-IFNα, respectively, in all participants.”
> “Tobevibart and elebsiran without or with PEG-IFNα resulted in functional cure in 11% (2/18) and 15% (2/13) of participants with HBsAg<1000 IU/mL, respectively. These proportions were 4% (2/51) and 10% (3/30) for the combinations without or with PEG-IFNα, respectively, in all participants.”
> “As previously communicated, Phase 3 development of combinations of tobevibart and elebsiran in CHB will not move forward without a global development and commercialization partner, which has not been secured.”
Source: [Vir Biotechnology press release (2025)](https://investors.vir.bio/news/news-details/2025/Vir-Biotechnology-Announces-Preliminary-24-Week-Post-End-of-Treatment-Data-for-Tobevibart-and-Elebsiran-Combinations-in-Chronic-Hepatitis-B-From-the-MARCH-Study/default.aspx)
###### Daplusiran/tomligisiran (JNJ-3989) with or without bersacapavir (REEF-1 phase 2b): nucleos(t)ide analogue stopping criteria
> “The primary endpoint was the proportion of patients meeting predefined nucleos(t)ide analogue-stopping criteria (alanine aminotransferase <3 × upper limit of normal, HBV DNA below the lower limit of quantitation, HBeAg negative, and HBsAg <10 IU/mL) at week 48.”
> “At week 48, five (5%; 90% CI 2-11) of 91 patients in the JNJ-3989 dual 40 mg group, 15 (16%; 10-24) of 92 in the JNJ-3989 dual 100 mg group, 18 (19%; 13-27) of 94 in the JNJ-3989 dual 200 mg group, eight (9%; 4-15) of 94 in the triple group, and one (2%; 0-10) of 45 in the control group met nucleos(t)ide analogue stopping criteria.”
> “29 (6%) of 460 patients in the treatment phase and in ten (2%) of 460 patients in the follow-up phase had grade 3 or 4 adverse events.”
> “Although treatment with JNJ-3989 led to a dose-dependent response for meeting nucleos(t)ide analogue-stopping criteria, it rarely led to HBsAg seroclearance.”
Source: [Yuen et al. (2023b)](https://pubmed.ncbi.nlm.nih.gov/37442152/)
###### Daplusiran/tomligisiran (JNJ-3989) with bersacapavir (REEF-2 phase 2b): functional cure after nucleos(t)ide analogue withdrawal
> “REEF-2, a phase IIb, double-blind, placebo-controlled, randomized study, enrolled 130 nucleos(t)ide analogue (NA)-suppressed hepatitis B e-antigen (HBeAg)-negative patients with CHB”
> “At follow-up Week 24, no patients achieved the primary endpoint of functional cure (off-treatment hepatitis B surface antigen [HBsAg] seroclearance). No patients achieved functional cure at follow-up Week 48.”
> “Off-treatment HBV DNA relapse and alanine aminotransferase increases were less frequent in the active arm, with 7/77 (9.1%) and 11/41 (26.8%) patients in the active and control arms, respectively, restarting NAs during follow-up.”
Source: [Agarwal et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/38583491/)
###### Daplusiran/tomligisiran (JNJ-3989) with pegylated interferon alfa-2a add-on (PENGUIN phase 2): HBsAg response and functional cure
> “In total, 48 patients (HBeAg positive, n = 11; HBeAg negative, n = 37) were enrolled; 47 reached follow-up week 48 (FUW48). Of the 48 patients, 31 (64.6%) achieved the primary endpoint; one achieved HBsAg seroclearance (<0.05 IU/ml) at both W24 and FUW48 after stopping NA.”
> “At W24, 15/48 (31.3%) patients met NA stopping criteria; 11/15 (73.3%) remained off NA by FUW48. One patient achieved functional cure at FUW48.”
> “Most patients had pronounced HBsAg reductions from baseline, no additional benefit from PegIFN-α2a, and did not achieve functional cure.”
Source: [Gane et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12409438/)
###### Imdusiran with pegylated interferon alfa-2a (IM-PROVE I phase 2a): functional cure after nucleos(t)ide analogue discontinuation
> “The IM-PROVE I study was a Phase 2a proof-of-concept study in 43 NA- suppressed, HBeAg-negative CHB subjects who received 4 doses of imdusiran (IDR) (60 mg every 8 weeks) prior to randomization to 24 weeks or 12 weeks of IFN with or without additional imdusiran doses.”
> “Six subjects in this study achieved functional cure after NA d/c; 3 additional subjects had HBV DNA “Functional cure rates in IM-PROVE I were highest amongst subjects who received 6 doses of imdusiran (60 mg every 8 weeks) and 24 weeks of weekly IFN starting at Week 28, compared to those that received shorter courses of imdusiran (4 doses) and/or IFN (12 weeks)”
> “Significant ALT flares were not observed in the subjects that achieved FC, although IFN treatment led to asymptomatic Gr 1 to Gr 3 ALT elevations in several subjects across the study cohorts”
Source: [Yuen et al. (2025)](https://www.arbutusbio.com/wp-content/uploads/2025/05/EASL-2025_THU-260-Yuen-MF-et-al.-IM-PROVE-I_FINAL.pdf)
###### Imdusiran (AB-729-001 phase 1a/b): regimens and safety
> “These participants received subcutaneous imdusiran as a single dose of 60 mg, 90 mg, or 180 mg (part 2) or as repeat doses of 60 mg or 90 mg every 4, 8, or 12 weeks for up to 48 weeks (part 3).”
> “All 83 enrolled participants received at least one dose of imdusiran or placebo and were included in the safety analyses. Across all parts, no participants discontinued imdusiran owing to an adverse event and no dose-related trends in reported treatment-emergent adverse events were observed across groups. There were no deaths.”
Source: [Yuen et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42173110/)
###### AHB-137, an unconjugated antisense oligonucleotide (first-in-human phase 1): HBsAg loss and safety
> “Twenty-four virally suppressed, HBeAg-negative CHB patients on stable nucleos(t)ide analog therapy were enrolled”
> “Treatment-related adverse events occurred in 73% of healthy subjects and 71% of CHB patients and were primarily mild or moderate injection-site reactions and headaches. No treatment-related serious adverse events, discontinuations, or deaths were observed.”
> “HBsAg loss was achieved in 3 (15.0%) patients with very low baseline HBsAg (≤1.5 IU/mL), was maintained through the end of the study in 2 patients, and was accompanied by anti-HBs seroconversion.”
> “Functional cure could not be assessed, as nucleos(t)ide discontinuation criteria were not prespecified.”
Source: [Gane et al. (2026b)](https://doi.org/10.1097/HEP.0000000000001835)
###### Antisense oligonucleotides compared with siRNAs: HBsAg responses described in the AHB-137 first-in-human report
> “siRNA monotherapy is generally safe but has produced modest HBsAg declines (1–2 log10 IU/mL), which plateau after 16–20 weeks and are not associated with HBsAg loss. Functional cure following siRNA therapy has only been reported after sequential interferon-α therapy.”
> “In contrast, in a phase 2b study of bepirovirsen (an ASO), with or without NA, rapid HBsAg reductions were observed, with up to 26% achieving HBsAg loss at the end of treatment and 9%–10% maintaining loss after treatment cessation.”
Source: [Gane et al. (2026b)](https://doi.org/10.1097/HEP.0000000000001835)
###### AHB-137 (phase 1a/1b): structural comparison with bepirovirsen, HBsAg response, and safety
> “AHB-137 and bepirovirsen share the same target sequence but differ in pharmacological structure. Bepirovirsen follows a conventional single-gap (5–10–5) gapmer architecture with a continuous central DNA gap flanked by terminal 2′-MOE modifications, whereas AHB-137 adopts a multi-segment structural design in which the gap is divided into shorter segments separated by modified regions, with additional site-specific 2′-modifications.”
> “In Phase 1b, 20 HBeAg-negative, nucleos(t)ide analogue (NA)-suppressed CHB patients with baseline HBsAg 100–1000 IU/mL received MAD AHB-137 (150 or 300 mg) or placebo (8:2), and 2 patients with baseline HBsAg 1000–3000 IU/mL received open-label AHB-137 300 mg.”
> “No serious adverse events, deaths or discontinuations occurred.”
> “Transaminase elevations were self-limiting; one Grade 3 ALT elevation in the 300 mg CHB cohort coincided with rapid HBsAg loss.”
> “cross-trial comparisons should be interpreted with caution due to the differences in baseline HBsAg range, sample size, and study design.”
Source: [Wang et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13518476/)
###### VRON-0200 therapeutic vaccine alone or followed by elebsiran plus tobevibart (phase 1b): HBsAg declines and safety
> “This phase 1b, randomised, open-label, multicentre trial included participants with chronic HBV infection aged between 18 and 55 years who had normal liver function, were receiving stable nucleos(t)ide therapy, and had non-detectable HBV DNA for 12 months or more.”
> “VRON-0200 was well tolerated, with 38 treatment-related adverse events reported (four of grade 2, 34 of grade 1); no treatment-related serious adverse events, discontinuations, or clinical laboratory abnormalities, including liver function test results, were reported.”
> “In groups 1 and 2, at day 360, 23 (85%) of 27 participants had sustained or continued HBsAg declines (12 [52%] of 23 had reductions of >50%) and four (15%) participants had declines of 1 log10 IU/mL or more from baseline.”
> “In group 3, the addition of investigational antivirals resulted in rapid and profound HBsAg declines within 7 days (all seven [100%] participants treated with elebsiran plus tobevibart had HBsAg concentrations <2 IU/mL; one [14%] had HBsAg concentrations below the LLOD), regardless of baseline HBsAg concentrations.”
Source: [Gane et al. (2026a)](https://pubmed.ncbi.nlm.nih.gov/42214405/)
### 2.2 Place of Product in Therapy
#### 2.2.1 Disease Description
##### 2.2.1.1 Definition and Etiology
###### Disease definition: hepatitis B surface antigen persisting for at least 6 months
> “The presence of HBsAg establishes the diagnosis of hepatitis B. Chronic vs acute infection is defined by the presence of HBsAg for at least 6 months.”
> “The presence of HBsAg for at least 6 months establishes the chronicity of infection.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Diagnostic criteria for chronic hepatitis B in the AASLD 2018 guidance
| Criterion | Quoted definition |
| --- | --- |
| Surface antigen | “HBsAg present for ≥6 months” |
| Viral load range | “Serum HBV DNA varies from undetectable to several billion IU/mL” |
| HBeAg subgroups | “Subdivided into HBeAg positive and negative. HBV DNA levels are typically >20,000 IU/mL in HBeAg-positive CHB, and lower values (2000–20,000 IU/mL) are often seen in HBeAg-negative CHB” |
| Aminotransferases | “Normal or elevated ALT and/or AST levels” |
| Histology | “Liver biopsy results showing chronic hepatitis with variable necroinflammation and/or fibrosis” |
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Causative agent: hepatitis B virus, a hepatotropic DNA virus of the Hepadnaviridae family
> “Hepatitis B is caused by infection with HBV. HBV is a 40–42-nanometer enveloped virus classified in the Hepadnaviridae family. HBV contains a circular, partially double-stranded DNA genome that is 3.2 kb in length. After a susceptible person is exposed, the virus enters the liver via the bloodstream. The liver is the primary site of HBV replication.”
> “Is classified by serologic subtype and genotype, which vary geographically.”
> “Is infectious for at least 7 days on surfaces.”
Source: [CDC Clinical Overview of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-overview/index.html)
###### Transmission routes: blood, sexual, perinatal, and percutaneous exposure
> “HBV is highly infectious and transmitted when blood, semen or other body fluids from a person infected with the virus enters the body of someone who is uninfected.”
Source: [CDC Clinical Overview of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-overview/index.html)
> “In highly endemic areas, hepatitis B is most commonly spread from mother to child at birth (perinatal transmission) or horizontal transmission through person-to-person contact in the presence of open cuts and sores, especially from an infected child to an uninfected child during the first 5 years of life.”
> “Hepatitis B is also spread by needlestick injury, tattooing, piercing and exposure to infected blood and body fluids, such as saliva and menstrual, vaginal and seminal fluids. Transmission of the virus may also occur through the sharing or reuse of contaminated needles and syringes or sharp objects either in health care settings, in the community or among persons who inject drugs. Sexual transmission is more prevalent in unvaccinated persons with multiple sexual partners.”
Source: [WHO hepatitis B fact sheet (2026)](https://www.who.int/news-room/fact-sheets/detail/hepatitis-b)
> “In regions with high endemicity, vertical transmission from mother to child during childbirth or through close personal contact contributes significantly to the prevalence of HBV infection. However, HBV can be transmitted through various routes, including perinatal transmission, sexual contact, sharing of contaminated needles or other injection equipment, and exposure to infected blood.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Age at infection and risk of chronicity
> “The risk for chronic infection varies according to the age at infection and is greatest among young children. Approximately 90% of infected infants and 30% of children infected between 1–5 years will remain chronically infected with HBV. By contrast, approximately 95% of infected adults recover completely from acute HBV infection and do not become chronically infected.”
> “The average incubation period for HBV is 60 days (range: 40–90 days) from exposure to onset of abnormal serum alanine aminotransferase (ALT) levels and 90 days (range: 60–150 days) from exposure to onset of signs and symptoms.”
Source: [CDC Clinical Overview of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-overview/index.html)
> “Hepatitis B infection acquired in adulthood leads to chronic hepatitis in less than 5% of cases, whereas infection in infancy and early childhood leads to chronic hepatitis in about 95% of cases.”
Source: [WHO hepatitis B fact sheet (2026)](https://www.who.int/news-room/fact-sheets/detail/hepatitis-b)
###### Genotypes: ten genotypes, with genotypes A, B, and C most prevalent in the United States
> “Ten genotypes of HBV have been identified labeled A through J (103, 104). The prevalence of HBV genotypes varies geographically. HBV genotypes A through H have been found in the United States, with genotypes A, B, and C being most prevalent (26). HBV genotypes may play an important role in the progression of HBV-related liver disease as well as response to interferon (IFN) therapy (103, 105).”
> “Studies from Asia found that HBV genotype B is associated with HBeAg seroconversion at an earlier age, more sustained remission after HBeAg seroconversion, less active hepatic necroinflammation, a slower rate of progression to cirrhosis, and a lower rate of HCC development compared with genotype C (103).”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “In terms of genotype, genotype C has been associated with a higher risk of HCC than genotype B in individuals with chronic HBV infection in Asia.105,196 In individuals from Africa (e.g. The Gambia), HBV genotype A has been identified as a risk factor for liver fibrosis202 and HCC199 compared with genotype E. In Alaska, genotype F was associated with the highest HCC risk.197”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Cirrhosis: liver stiffness thresholds used to stage HBV-related fibrosis
> “In an optimal setting, liver fibrosis is assessed using LSM, with defined cut-off values for VCTE indicating significant fibrosis (7.2-7.9 kPa), advanced fibrosis (8.8-9.4 kPa) and cirrhosis (≥11.7-12.2 kPa), as shown in two systematic reviews and meta-analyses focused on individuals with HBV infection.”
> “The most recent meta-analysis, focused exclusively on individuals with HBV infection, proposes thresholds of 6.0–8.0 kPa for significant fibrosis (with a cut-off of >7.0 kPa identifying most cases), >8.0–11.0 kPa for advanced fibrosis, and >11.0–14.0 kPa for cirrhosis.”
> “The Baveno VI consensus introduced the term “compensated advanced chronic liver disease (cACLD)” to describe patients with advanced fibrosis or early cirrhosis who remain asymptomatic but are at risk of developing clinically significant portal hypertension (CSPH) and disease progression.80 Liver stiffness values <10 kPa were proposed as a safe cut-off for excluding cACLD and values >15 kPa as highly suggestive of cACLD.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Resolution terms: functional cure and partial cure
| Term | Quoted definition |
| --- | --- |
| Functional cure | “HBsAg-negative and HBV DNA undetectable off treatment for at least 6 mo (± anti-HBs)” |
| Partial cure | “HBsAg <100 IU/mL with HBV DNA undetectable off treatment for at least 6 mo” |
| HBsAg loss | “Loss of HBsAg on antiviral therapy or spontaneously in person who was previously HBsAg-positive” |
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “The recommended endpoint of novel therapy is functional cure defined as HBsAg loss using a conventional assay for detection of HBsAg (limit of detection 0.05 IU/mL) and HBV DNA below the lower limit of quantification (i.e. < 10 IU/ml) at 24 weeks off-therapy.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
> “Loss of HBsAg with acquisition of anti-HBs has been termed functional cure. This is distinguished from true cure, in which HBsAg and covalently closed circular DNA are eliminated.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
##### 2.2.1.2 Epidemiology
###### 2.2.1.2.1 Incidence of Chronic hepatitis B virus infection in adults without cirrhosis
###### United States, 2023: reported acute hepatitis B cases, estimated infections, and rate
> “During 2023, a total of 2,214 acute hepatitis B cases were reported to CDC by 47 states and the District of Columbia, corresponding to an estimated 14,400 acute infections (95% CI: 8,200–35,200) after adjusting for case underascertainment and underreporting”
> “The reported case count corresponds to a rate of 0.7 cases per 100,000 population. Following a decade of stable rates from 2011–2019, a decrease was observed from 2019–2020, and rates have remained relatively stable through 2023.”
> “A total of 779 patients, or 64% of 1,215 cases for which hospitalization information was available, were hospitalized due to acute hepatitis B during 2023.”
Source: [CDC Viral Hepatitis Surveillance Report national profile (2025)](https://www.cdc.gov/hepatitis-surveillance-2023/about/national-profile.html)
###### United States, 2023: acute hepatitis B by age, sex, race and ethnicity, and reported risk
> “The highest rate of reported acute hepatitis B cases was among persons aged 40–49 years (1.4 cases per 100,000 population), followed by persons aged 50–59 years (1.2 cases per 100,000 population).”
> “Most acute hepatitis B cases were reported among males (62%). In 2023, the rate of reported cases was 1.7 times as high among males compared to females.”
> “The rate of reported acute hepatitis B cases among non-Hispanic Black persons was 1.9 times as high compared to non-Hispanic White persons.”
> “During 2023, the most commonly reported risks (based on proportion of cases with available data reporting the risk) included injection drug use (19% of the 963 cases with information available), having multiple sexual partners (20% of the 528 cases with information available), and male-to-male sexual contact (21% of the 256 male cases with information available).”
Source: [CDC Viral Hepatitis Surveillance Report national profile (2025)](https://www.cdc.gov/hepatitis-surveillance-2023/about/national-profile.html)
###### United States, 2023: newly reported chronic hepatitis B cases and rate
> “During 2023, a total of 17,650 newly reported cases of chronic hepatitis B were reported to CDC by 44 states and the District of Columbia, corresponding to a rate of 6.1 cases per 100,000 population. Approximately 89% of newly reported cases of chronic hepatitis B were among persons aged 30 years and older, and most were reported among males (57%).”
> “The rate of newly reported chronic hepatitis B cases was highest among non-Hispanic A/PI persons (18.9 cases per 100,000 population), which was 9.9 times the rate among non-Hispanic White persons (1.9 cases per 100,000 population).”
Source: [CDC Viral Hepatitis Surveillance Report national profile (2025)](https://www.cdc.gov/hepatitis-surveillance-2023/about/national-profile.html)
> “The rate of newly reported chronic hepatitis B cases was highest among persons aged 30–39 and 40–49; these two age groups combined accounted for 46% of all newly reported chronic hepatitis B cases.”
> “Although the rate of reported acute hepatitis B cases was the lowest among non-Hispanic A/PI persons, the rate of newly reported chronic hepatitis B cases was highest among this group.”
Source: [CDC Viral Hepatitis Surveillance Report (2025)](https://www.cdc.gov/hepatitis-surveillance-2023/hepatitis-b/index.html)
###### United States, 2020 model: new chronic infections imported through immigration
> “In 2020, it was estimated that 96% (35,000 imported out of 36,400 new chronic cases) of all chronic HBV incident cases (new chronic infections) were among immigrants entering the country, imported chronic cases, with the rest caused by ongoing transmission occurring within the US.”
Source: [Razavi-Shearer et al. (2023a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10239007/)
###### Global, 2024: new hepatitis B virus infections
> “Globally, the number of people newly infected with HBV in 2024 was 0.9 million (95% UI: 0.7–1.2 million); this was a decline of 32% from 2015. The WHO African Region accounted for 68% of new infections in 2024.”
Source: [WHO Global hepatitis report (2026)](https://iris.who.int/server/api/core/bitstreams/6f6caedc-37a0-49ee-a02a-df9c3b78ff42/content)
> “WHO estimates that 240 million people were living with chronic hepatitis B infection in 2024, with 0.9 million new infections each year.”
Source: [WHO hepatitis B fact sheet (2026)](https://www.who.int/news-room/fact-sheets/detail/hepatitis-b)
###### 2.2.1.2.2 Prevalence of Chronic hepatitis B virus infection in adults without cirrhosis
###### United States, NHANES 2013 to 2018: prevalence of chronic infection and share born outside the United States
> “Non-US-born residents accounted for 69.1% of the population with chronic HBV infection and were 9.1 times more likely to be living with chronic hepatitis B, compared with US-born persons.”
> “Despite increasing immune protection among young persons vaccinated after birth, the estimated prevalence of persons living with chronic hepatitis B in the USA has remained unchanged at 0.3% since 1999.”
Source: [Roberts et al. (2021)](https://pubmed.ncbi.nlm.nih.gov/34097776/)
###### United States, NHANES 2017 to March 2020: prevalence, number infected, and awareness
> “During the years 2013–2018, 880,000 persons or 0.3% of the US population aged 6 years and older were estimated to have HBV infection; among these persons, 69.1% were non–US-born, and the prevalence of HBV infection was highest among non-Hispanic (NH) Asian persons.”
> “Among persons aged 6 years and older, 4.0% (95% CI: 3.1%–4.9%) had past or present hepatitis B; and 0.2% (95% CI: 0.1%–0.3%) or an estimated 660,000 (95% CI: 410,000–1,000,000) persons had HBV infection, among whom 49.8% (95% CI: 25.1%–74.6%) were aware of their infection.”
> “NH-Asian persons accounted for 48.4% (95% CI: 30.6%–66.5%) and non–US-born persons accounted for 73.6% (95% CI: 50.6%–90.0%) of all persons with HBV infection.”
> “No persons under the age of 20 years were identified with HBV infection; therefore, estimates for persons aged 20 years or older are included in Table 1.”
> “Similarly, the current prevalence estimate is not statistically different from the previous estimate of 880,000.”
Source: [Bixler et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10069827/)
###### United States, 2018: foreign-born persons with chronic infection by region of origin
> “Although prevalence of chronic hepatitis B (CHB) in the USA includes 0.42 million (range, 0.28‐0.67) U.S.‐born persons, foreign‐born (FB) persons contribute a substantially larger number to the burden of CHB in the USA.”
> “The weighted average CHB prevalence for all FB in the USA in 2018 was 3.07%. Approximately 59% of FB with CHB in the USA in 2018 emigrated from Asia, 19% from the Americas, and 15% from Africa.”
> “Using FB populations from ACS and country‐specific CHB pooled rates from the mid‐range RE meta‐analyses, we estimate that the number of FB with CHB living in the USA in 2018 was 1.47M persons (95% CI, 1.21‐1.73; Table 1).”
> “Including FB and U.S.‐born persons, the total prevalence of CHB in the USA may be as high as 2.4 million.”
Source: [Wong et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8453838/)
###### United States, 2019 expert panel: estimated number with chronic infection
> “The panel proposed an overall estimated prevalence for chronic HBV infection in the US of 1.59 million persons (range 1.25-2.49 million).”
Source: [Lim et al. (2020)](https://pubmed.ncbi.nlm.nih.gov/32483003/)
###### United States, 2020 model: number infected, age distribution, and share among immigrants
> “In 2020, it is estimated that there were a total of 1.8 million (95% uncertainty interval: 1.3–2.6 million) HBV-positive individuals in the US, corresponding to a prevalence of 0.55% (UI: 0.41–0.77%) in all ages.”
> “The analysis estimated that almost 1.4 million of these infections, or 76% (1.4 million out of 1.8 million total infections) of all estimated infections, were among immigrants.”
> “Of all HBV infections, 82% (1.15 million out of 1.4 million) fell within the ages 30–74.”
Source: [Razavi-Shearer et al. (2023a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10239007/)
###### United States and Puerto Rico, 2021 model: national and state prevalence
> “Utilising this bottom up approach to estimate the prevalence of HBV in the United States, we estimate there are 1.7 million (UI: 795,000–4.1 million) people living with HBV in the United States and Puerto Rico, corresponding to a prevalence of 0.50% (UI: 0.24%–1.23%; Table 1).”
> “Of these cases, 76% are estimated to be among the foreign‐born population (1.3 million, UI: 589,000–3.1 million), with 396,000 (UI: 206,000–1,007,000) cases being among the non‐foreign‐born population (Table 1).”
> “The highest HBV prevalence was found in Hawai‘i, 1.3% (UI: 0.5%–4.0%); California, 0.9% (UI: 0.5%–1.9%); New York, 0.8% (UI: 0.4%–1.7%); Maryland, 0.8% (UI: 0.4%–1.7%); and New Jersey, 0.8% (UI: 0.4%–1.5%; Figure 1).”
Source: [Razavi-Shearer et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12715829/)
> “CHB affects approximately 1.7 million people in the US”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### United States: range of published estimates cited in the 2023 CDC screening recommendations
> “An estimated 580,000 to 2.4 million persons are living with HBV infection in the United States (5,6), two thirds of whom might be unaware of their infection (5).”
> “Chronic HBV infection disproportionately affects persons born outside the United States; non-U.S.–born persons account for 14% of the general population, but account for 69% of the U.S. population living with chronic HBV infection (5–7).”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
###### United States: proportion diagnosed, aware, and treated
> “By 2020, we estimate that approximately 334,800 chronic HBV infections were diagnosed in the US, corresponding to a diagnosis coverage of 18% (334,800 diagnosed out of 1.8 million infected) with just under 17% (90,500 treated out of 534,100 eligible) of all eligible individuals on treatment.”
Source: [Razavi-Shearer et al. (2023a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10239007/)
> “An estimated 1.3 million (95% CI, 0.9–1.7 million) persons in the United States were HBV-infected. 34% (95% CI, 19%–54%) of HBV-infected persons reported awareness and 28% (95% CI, 10%–57%) of aware persons reported ever having HBV treatment.”
Source: [Zhou and Terrault (2020)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8028744/)
> “32.4 percent of persons with chronic hepatitis B were aware they have chronic hepatitis B in 2013-16”
Source: [ODPHP Healthy People 2030 IID-13](https://odphp.health.gov/healthypeople/objectives-and-data/browse-objectives/infectious-disease/increase-proportion-people-who-know-they-have-chronic-hepatitis-b-iid-13)
###### United States, commercially insured adults 2003 to 2019: evaluation, treatment eligibility, and treatment
> “We included 12,608 eligible patients in the study analysis (mean age 45.7 years, 52.1% male, 54.6% Asian, 18.1% Caucasian, 10.5% African American).”
> “Of those with an adequate evaluation, 11.2% were treatment eligible by AASLD criteria and 13.9% by EASL criteria; 60.4% of AASLD eligible patients and 54.3% of EASL eligible patients received treatment within 12 months from becoming eligible.”
Source: [Ye et al. (2022)](https://pubmed.ncbi.nlm.nih.gov/34474097/)
###### Quantitative HBsAg distribution relevant to the 3,000 IU/mL eligibility threshold
> “In a key secondary endpoint, a functional cure rate of 26% (200 of 768 vs. 0 of 393 in the placebo group) was achieved in participants with ≤1000 IU/ml HBsAg level, a group that represents approximately 45% of diagnosed CHB cases globally.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Nucleos(t)ide analogue-treated trial participants: HBsAg distribution before peg-interferon add-on
> “Mean age was 43 (±11) years, mean SOT HBsAg was 3.03 (±0.94) log10 IU/mL (HBsAg<100 IU/mL: 69 (12%); 100–1000: 163 (28%); ≥1000: 342 (60%)), mean HBV DNA was 1.58 (±0.78) log10 IU/mL, with 517 (89%) patients having HBV DNA<100 IU/mL”
Source: [Dongelmans et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13638273/)
###### Global, 2024: prevalence, diagnosis, and treatment coverage
> “In 2024, 240 million people (95% UI: 202–296 million) were living with a chronic HBV infection, equivalent to 2.9% (95% UI: 2.5–3.6%) of the global population.”
> “Based on the latest WHO guidelines, approximately 50% of people with HBV infection worldwide are eligible for treatment.”
> “Globally in 2024, only 27% of the estimated 240 million people with HBV infection had been diagnosed and 4.3% were on treatment.”
Source: [WHO Global hepatitis report (2026)](https://iris.who.int/server/api/core/bitstreams/6f6caedc-37a0-49ee-a02a-df9c3b78ff42/content)
> “Forty-three million people are infected in the WHO South-East Asia Region, 16 million in the WHO Eastern Mediterranean Region, 9.7 million in the WHO European Region and 5 million in the WHO Region of the Americas.”
> “In 2024 only 10 million people were on antiviral treatment, this being equivalent to 4.3% of all people living with chronic hepatitis B.”
Source: [WHO hepatitis B fact sheet (2026)](https://www.who.int/news-room/fact-sheets/detail/hepatitis-b)
###### Global, 2022 model: prevalence, diagnosis, and treatment of eligible persons
> “We developed models for 170 countries which resulted in an estimated global prevalence of HBV infection in 2022 of 3·2% (95% uncertainty interval 2·7-4·0), corresponding to 257·5 million (216·6-316·4) individuals positive for HBsAg. Of these individuals, 36·0 million were diagnosed, and only 6·8 million of the estimated 83·3 million eligible for treatment were on treatment.”
Source: [Polaris Observatory Collaborators (2023)](https://pubmed.ncbi.nlm.nih.gov/37517414/)
###### Proportion with cirrhosis among adults with chronic infection, United States
No evidence found.
##### 2.2.1.3 Natural History, Survival, and Mortality
###### Phases of chronic infection: AASLD/IDSA 2025 definitions
| Phase | Quoted definition |
| --- | --- |
| Immune-tolerant | “HBeAg-positive, HBV DNA ≥10,000,000 IU/mL and normal ALT (<25 IU/mL in women, <35 IU/mL in men)” |
| Immune active, HBeAg-positive | “HBeAg-positive and ALT ≥2xULN and HBV DNA ≥20,000 IU/mL” |
| Immune active, HBeAg-negative | “HBeAg-negative and ALT ≥2xULN and HBV DNA ≥2000 IU/mL” |
| Inactive | “HBeAg-negative, HBV DNA <2000 IU/mL and normal ALT” |
| Indeterminate | “HBeAg-positive or negative with HBV DNA level and/or ALT level outside those with immune-tolerant, immune active or inactive CHB” |
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “Up to 40% of adults with CHB do not meet one or more criteria for a defined phase and are in indeterminate phases.2,3 Indeterminate phases are more common in persons who are HBeAg-negative than HBeAg-positive.”
> “Transition from the immune-tolerant to immune active phase of CHB may occur in childhood, adolescence, or adulthood, with the average age of transition around 30 years.”
> “While some individuals in the indeterminate phase may transition to an immune active or an inactive phase, many remain in the indeterminate phase for years. Several cohort studies suggest that individuals who remain in the indeterminate phase are at risk of HCC.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Phases of chronic infection: EASL 2025 serologic profile and untreated disease progression
| Marker | HBeAg-positive chronic HBV infection | HBeAg-positive chronic hepatitis B | HBeAg-negative chronic HBV infection | HBeAg-negative chronic hepatitis B |
| --- | --- | --- | --- | --- |
| HBsAg | “High” | “Intermediate to high” | “Low, usually <1,000 IU/ml” | “Intermediate, usually >1,000 IU/ml” |
| ALT | “Normal” | “Elevated” | “Normal” | “Elevated” |
| Liver disease progression (if untreated) | “None/minimal” | “Moderate to severe” | “None” | “Mild to severe” |
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
> “Chronic HBV infection is a dynamic and complex condition that progresses through distinct phases (Table 4), each characterised by unique virological, immunological and clinical features.”
> “A significant proportion of individuals with chronic HBV infection cannot be easily classified into the four phases outlined in the 2017 EASL CPGs,5 which are also adopted in this new guideline.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Clinical outcomes in the indeterminate phase
> “The annual incidence rate of HCC in patients in the indeterminate phase was 0.32% (95% CI 0.21-0.48%, I2 = 85.7%), and those of cirrhosis and hepatic decompensation were 0.67% (95% CI 0.30-1.49%, I2 = 94.3%) and 0.34% (95% CI 0.17-0.69%, I2 = 51.8%), respectively. The pooled prevalence of moderate-to-severe liver inflammation, significant fibrosis, advanced fibrosis, and cirrhosis was 40.7%, 39.7%, 17.9%, and 7.2%, respectively.”
Source: [Lai et al. (2025)](https://pubmed.ncbi.nlm.nih.gov/39577468/)
###### Transition from inactive infection to HBeAg-negative hepatitis
> “The annual incidence of HBeAg-negative immune active hepatitis among inactive carriers is estimated to be 0.37%.”
Source: [Lok et al. (2017)](https://pmc.ncbi.nlm.nih.gov/articles/PMC6294322/)
> “A higher risk of reactivation, i.e. progression from HBeAg-negative infection to HBeAg-negative hepatitis, exists with HBV DNA <2,000 IU/ml and HBsAg >1,000 IU/ml.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Spontaneous HBsAg loss: approximately 1% per year in pooled cohorts
> “The pooled annual rate of HBsAg seroclearance was 1.02% (95% CI, 0.79-1.27). Cumulative incidence rates were 4.03% at 5 years (95% CI, 2.49-5.93), 8.16% at 10 years (95% CI, 5.24-11.72), and 17.99% at 15 years (95% CI, 6.18-23.24).”
> “A higher proportion of patients who tested negative for HBeAg at baseline had seroclearance (1.33%; 95% CI, 0.76-2.05) than those who tested positive for HBeAg (0.40%; 95% CI, 0.25-0.59) (P < .01).”
> “In a systematic review and meta-analysis, we found a low rate of HBsAg seroclearance in untreated and treated patients (pooled annual rate, approximately 1%).”
Source: [Yeo et al. (2019)](https://pubmed.ncbi.nlm.nih.gov/30342034/)
> “Spontaneous HBsAg loss has been reported to occur at the rate of roughly 1% per year, but this rare event does not occur at a linear rate (128, 129). In a study of 1076 patients with CHB in Taiwan, cumulative probabilities of spontaneous HBsAg loss were 8.1% after 10 years and increased to 44.7% after 25 years (129).”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Spontaneous HBsAg loss: higher rates in HBeAg-negative infection with low HBsAg, lower rates on nucleos(t)ide analogue therapy
> “The annual incidence of HBsAg loss in this population is approximately 2%, increasing further (up to 7%) in older individuals and those with low HBsAg levels (<100 or <250 IU/ml).”
> “This rate is significantly higher than in NA-treated patients with chronic HBV infection, where the reported average annual rate is ≤0.33%.”
> “Although spontaneous HBsAg seroclearance is unusual in chronic HBV infection, its likelihood increases with age and annual HBsAg monitoring is recommended to detect such events.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Cirrhosis incidence in untreated chronic infection
> “The reported incidence rates of cirrhosis in chronic HBV infection have come mostly from tertiary care centers, and range from 2% to 7% annually.5–9 In contrast, in a study of 1506 asymptomatic HBV carriers, the cirrhosis incidence rate was 0.7% annually.”
> “The 3582 patients under study were followed up for a mean of 11 years and contributed 40,038 person-years of observation and by June 30, 2004; a total of 1053 (29.4%) participants dropped out of follow-up evaluation. There were 365 (10%) patients newly diagnosed with cirrhosis.”
Source: [Iloeje et al. (2006)](https://doi.org/10.1053/j.gastro.2005.11.016)
###### Hepatocellular carcinoma incidence by baseline viral load in the REVEAL-HBV cohort
> “There were 164 incident cases of hepatocellular carcinoma and 346 deaths during a mean follow-up of 11.4 years and 41 779 person-years of follow-up. The incidence of hepatocellular carcinoma increased with serum HBV DNA level at study entry in a dose-response relationship ranging from 108 per 100 000 person-years for an HBV DNA level of less than 300 copies/mL to 1152 per 100 000 person-years for an HBV DNA level of 1 million copies/mL or greater. The corresponding cumulative incidence rates of hepatocellular carcinoma were 1.3% and 14.9%, respectively.”
Source: [Chen et al. (2006)](https://doi.org/10.1001/jama.295.1.65)
###### Hepatocellular carcinoma incidence in untreated immune-tolerant and treated immune-active U.S. Veterans
> “A total of 591 U-IT and 555 T-IA CHB patients were identified (mean age 56.4-57.5 years, 45%-50% non-Hispanic white, 37%-40% African American, 9%-10% Asian, 25%-29% concurrent diabetes, 35%-39% with FIB-4 > 3.25). Over a median follow up of 6.4 years (IQR 3.0-10.4), incidence of HCC was significantly lower in U-IT patients vs. T-IA patients (0.28 vs. 0.54 per 100 person-years; HR 0.52, 95% CI 0.32-0.83, p = 0.007). However, the risk of cirrhosis or all-cause mortality was similar between both T-IA and U-IT CHB patients.”
Source: [Wong et al. (2026b)](https://pubmed.ncbi.nlm.nih.gov/42411035/)
###### Mortality in the United States: hepatitis B-related deaths reported in national surveillance
> “There were 1,769 hepatitis B-related deaths reported during 2023.”
Source: [CDC Viral Hepatitis Surveillance Report (2025)](https://www.cdc.gov/hepatitis-surveillance-2023/hepatitis-b/index.html)
> “The age-adjusted hepatitis B-related death rate during 2023 (0.44 deaths per 100,000 population) remained stable compared to 2022.”
> “In 2023, hepatitis B-related death rates among non-Hispanic Asian/Pacific Islander persons and non-Hispanic Black persons were 8.5 times and 2.7 times as high as the rate among non-Hispanic White people, respectively.”
Source: [CDC Clinical Overview of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-overview/index.html)
###### Mortality in the United States: death certificate analysis, 2000 to 2019
> “A total of 35 280 decedents with hepatitis B listed as the cause of death were identified, including 17 483 deaths during 2010 to 2019. Decedents were 63.3% US-born, and 25.8% of decedents were Asian or Pacific Islander and 46.5% of decedents were White; 28.4% of decedents were listed as having hepatitis C virus (HCV) or HIV coinfection.”
> “Liver cancer was the predominant UCOD among non-US–born decedents (37.9% of decedents). From 2000 to 2009 compared with 2010 to 2019, the hepatitis B–listed mortality rate significantly decreased nationally (change, −18.97%) and in 14 states; significant increases were observed in West Virginia (change, 83.78%) and Kentucky (change, 69.44%).”
Source: [Ly et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9240905/)
###### Mortality in the United States: premature death and underreporting in the Chronic Hepatitis Cohort Study
> “Of 4389 CHB patients followed for a mean of 5.38 years, 492 (11%) CHB patients died after a mean follow-up of 3.00 years.”
> “CHB patients died at an average age of 59.8 years”
> “14 years younger than the general U.S. population”
> “and at higher rates for all causes (relative risk [RR] = 1.85, 95% confidence interval [CI], 1.851–1.857) and liver-related causes (RR = 15.91, 95% CI, 15.81–16.01). Only 19% of CHB decedents and 40% of those dying of liver disease had hepatitis B reported on their death certificates.”
Source: [Bixler et al. (2019)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11230463/)
###### Projected U.S. liver-related deaths, 2019 to 2030
> “The annual incidence of decompensated cirrhosis is projected to increase by 20% from 2019 to 2030 from 1700 (UI: 1100–2700) to 2100 (UI: 1300–3300) cases, hepatocellular carcinoma (HCC) annual incidence is forecasted to increase by 31% from 6500 (4500–9600) 8500 (UI: 5900–12,500) cases, and liver related deaths are expected to increase by 25% from 7900 (UI: 5500–11,600) to 9900 (UI: 6600–14,900) deaths annually.”
Source: [Razavi-Shearer et al. (2023a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10239007/)
###### Global mortality: approximately 1.1 million HBV-related deaths in 2024
> “In 2024, hepatitis B resulted in an estimated 1.1 million deaths, mostly from cirrhosis and hepatocellular carcinoma (primary liver cancer).”
Source: [WHO hepatitis B fact sheet (2026)](https://www.who.int/news-room/fact-sheets/detail/hepatitis-b)
> “Globally in 2024, there were an estimated 1.1 million (95% uncertainty interval [UI]: 0.9–1.3 million) HBV-related deaths”
> “Globally, the annual number of HBV-related deaths increased by 17% between 2015 and 2024”
Source: [WHO Global hepatitis report (2026)](https://iris.who.int/server/api/core/bitstreams/6f6caedc-37a0-49ee-a02a-df9c3b78ff42/content)
> “HBV-related diseases resulted in 555 000 global deaths (487 000 to 630 000) in 2019.”
Source: [GBD 2019 Hepatitis B Collaborators (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9349325/)
> “HBV-related deaths are projected to rise globally from 858,000 in 2015 to 1,149,000 in 2030, alongside increasing HCC incidence (from 644,000 to 857,000) and cases of decompensated cirrhosis (from 296,000 to 403,000), assuming that current levels of diagnosis and treatment remain unchanged.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
##### 2.2.1.4 Pathophysiology
###### Immune-mediated liver injury by a non-cytopathic virus
> “As HBV is not directly cytopathic, host responses to the virus-infected hepatocytes are believed to mediate liver cell injury and, with long-term chronic liver inflammation and ineffective immune-mediated viral clearance, contribute to the development of cirrhosis and liver cancer (92), (93).”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “Whereas HBV appears to induce little or no innate immune activation, the adaptive immune response mediates both viral clearance as well as liver disease.”
Source: [Iannacone and Guidotti (2022)](https://pubmed.ncbi.nlm.nih.gov/34002067/)
###### Covalently closed circular DNA: the nuclear transcriptional template and long-lived reservoir
> “The host DNA repair machinery9 converts the incoming DNA to covalently closed circular DNA (cccDNA) molecules that are packaged into chromatin-like minichromosomes by histone and non-histone proteins,10,11 whereupon it acts as the HBV transcriptional template and long-lived reservoir in the hepatocyte nucleus.”
Source: [Revill et al. (2019)](https://pmc.ncbi.nlm.nih.gov/articles/PMC6732795/)
> “A major hurdle to HBV “cure” is the presence of cccDNA in the hepatocyte nucleus in a non-integrated form or episome. cccDNA serves as the template for transcription of all viral RNAs including pregenomic RNA and thus plays a key role in the viral lifecycle.”
> “The half-life of cccDNA is long thus explaining why it is difficult to cure HBV infection and why HBV can reactivate either spontaneously or following immune suppression, many years after clearance of HBsAg.”
Source: [Lok et al. (2017)](https://pmc.ncbi.nlm.nih.gov/articles/PMC6294322/)
> “Current therapies (pegylated interferon alfa [pegIFNa] and nucleos(t)ide analogues [NAs]) are not curative due to persistence of covalently closed circular DNA (cccDNA), a stable, non-integrated form of viral DNA located in the hepatocyte nucleus, as well as HBV DNA that is directly integrated into the host genome.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
###### Integrated HBV DNA: a source of HBsAg independent of viral replication
> “Integrated HBV DNA is derived from linear genomic DNA present in viral particles or produced from aberrantly processed relaxed circular genomic DNA following an infection, and can drive expression of hepatitis B surface antigen (HBsAg) and HBx. DNA integration events accumulate over the course of viral infection, ranging from a few percent during early phases to nearly 100 percent of infected cells after prolonged chronic infections.”
> “Because integrated DNA is responsible for persistence of HBsAg in the absence of viral replication it impacts established criteria for the resolution of HBV infection, which rely on HBsAg as a diagnostic marker.”
Source: [Zoulim et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/38971531/)
> “Hindering the goal of functional cure as a treatment endpoint is the fact that HBsAg in serum originates from two sources, cccDNA and integrated HBV DNA. Although novel treatments in development may potentially eliminate or silence cccDNA, they may not abolish ongoing RNA transcription from integrated viral genomes, and HBsAg would remain detectable in serum.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
> “Although qHBsAg reflects covalently closed circular DNA and intrahepatic DNA levels, it also measures HBsAg that arises from integrated DNA, thereby reducing its specificity as a biomarker for viral replication.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Limited effect of nucleos(t)ide analogues on cccDNA and HBsAg production
> “Since NAs do not directly affect the HBV cccDNA transcriptional template, a modest decrease in cccDNA is observed after long-term NA therapy, most likely due to the indirect impact of NAs on de novo infections and intracellular replenishment coupled with the gradual dilution of the cccDNA pool through cell division.253,254 Low rates of HBsAg loss on NA treatment are ascribed to the limited effect of NAs on the cccDNA template and to the significant contribution of HBV integration to HBsAg production, especially in HBeAg-negative individuals.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
> “By contrast, nucleos(t)ide analogues only inhibit HBV genome replication; they have minimal effects on the immune response or the cccDNA minichromosome reservoir, and are not curative.”
Source: [Revill et al. (2019)](https://pmc.ncbi.nlm.nih.gov/articles/PMC6732795/)
> “Continued transcription from cccDNA and integrated viral genomes may explain the relatively minor decrease in serum HBsAg levels during NA therapy despite undetectable serum HBV DNA levels.”
Source: [Lok et al. (2017)](https://pmc.ncbi.nlm.nih.gov/articles/PMC6294322/)
###### HBsAg and T-cell exhaustion
> “HBV-specific T cells necessary for HBV control (and may also play a role in hepatic inflammation) are dysfunctional and may be depleted or deleted in chronic HBV.53,54 Their exhausted phenotype has been attributed to persistent antigen exposure and increased expression of T cell inhibitory responses,3,52,55 providing the basis for the focus on reducing HBsAg production.”
Source: [Lok et al. (2017)](https://pmc.ncbi.nlm.nih.gov/articles/PMC6294322/)
> “Chronic exposure to high levels of HBV antigens, especially HBsAg, results in host immune dysfunction. Multiple immune signaling pathways are influenced by HBV antigens, which ultimately result in virus-specific and global T-cell dysfunction [43, 44].”
Source: [Hui et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11750937/)
> “For example, we now trust that HBV integration into the host genome often serves as a relevant source of hepatitis B surface antigen (HBsAg) expression during chronic infection, possibly triggering dysfunctional T cell responses and favouring detrimental immunopathology.”
Source: [Iannacone and Guidotti (2022)](https://pubmed.ncbi.nlm.nih.gov/34002067/)
> “More recent evidence suggests that HBsAg expression from integrated DNA might contribute to HBV pathogenesis by attenuating the immune response.”
Source: [Zoulim et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/38971531/)
> “During acute infection, cccDNA can be silenced and/or degraded through immune mechanisms, however in chronic infection the immune responses are dysfunctional and not easily restored by current treatments.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
###### Integration and hepatocarcinogenesis
> “HBV DNA integration events have primarily been investigated in the context of hepatocellular carcinoma development as they can activate known oncogenes and other growth promoting genes, cause chromosomal instability and, presumably, induce epigenetic alterations, promoting tumour growth.”
Source: [Zoulim et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/38971531/)
> “Antiviral therapy may decrease HCC risk by suppressing viral replication, thereby decreasing clonal expansion and integration of HBV DNA into the host genome.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Rationale for HBsAg loss as the treatment goal
> “Of all these surrogate endpoints, HBsAg loss is considered to be the most relevant because HBsAg seroclearance is associated with sustained off-treatment improvement in clinical outcomes.(1, 2) Additionally, HBsAg loss has been shown to have an additional clinical benefit (lower rates of HCC and hepatic decompensation) over HBV DNA suppression alone, particularly in patients with cirrhosis.(3, 4) Moreover, HBsAg seroclearance is easy to measure with standardized and widely available assays.”
> “Nonetheless, a sustained seroclearance of HBsAg, (i.e., rendering HBsAg to levels below the currently accepted detection enzyme immune assays, <0.05 IU/ml), plausibly implies profound suppression of replication of HBV, and suggests reduced overall expression from cccDNA and integrated viral genomes.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
> “Increasingly, there is emphasis on the achievement of HBsAg loss as the desired endpoint for treatment (functional cure), because of its association with reduction in clinical outcomes and long-term durability, though it is recognized that functional cure is infrequent with current approved therapies, albeit higher with peginterferon than for NAs.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “Loss of HBsAg (post therapy) is the ultimate goal of treatment, is the defining feature of functional cure of HBV infection,55 and is associated with an improved prognosis.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
##### 2.2.1.5 Diagnosis
###### Serologic definition of chronic infection
> “The presence of HBsAg establishes the diagnosis of hepatitis B. Chronic vs acute infection is defined by the presence of HBsAg for at least 6 months.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “HBsAg: HBsAg is a protein on the surface of HBV that can be detected in high levels in serum during acute or chronic HBV infection.”
> “The presence of total anti-HBc indicates previous or ongoing infection with HBV in an undefined time frame. People who have immunity to hepatitis B from a vaccine do not develop anti-HBc.”
> “IgM anti-HBc positivity indicates recent infection with HBV (within less than 6 months). Its presence indicates acute infection.”
Source: [CDC Clinical Testing and Diagnosis for Hepatitis B (2026)](https://www.cdc.gov/hepatitis-b/hcp/diagnosis-testing/index.html)
###### Universal adult screening with the triple panel: CDC 2023 recommendations
> “New recommendations include hepatitis B screening using three laboratory tests at least once during a lifetime for adults aged ≥18 years.”
> “Triple panel screening: Using the triple panel (HBsAg, anti-HBs, and total anti-HBc) is recommended for initial screening because it can help identify persons who have an active HBV infection and could be linked to care, have resolved infection and might be susceptible to reactivation (e.g., immunosuppressed persons), are susceptible and need vaccination, or are vaccinated.”
> “Universal screening: Universal screening of adults is cost-effective compared with risk-based screening and averts liver disease and death (56).”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
> “Screen all adults aged 18 and older for hepatitis B at least once in their lifetime using a triple panel test. To ensure increased access to testing, anyone who requests HBV testing should receive it regardless of disclosure of risk.”
Source: [CDC Clinical Testing and Diagnosis for Hepatitis B (2026)](https://www.cdc.gov/hepatitis-b/hcp/diagnosis-testing/index.html)
###### Risk-based screening: USPSTF 2020 recommendation
> “Up to 60% of HBV-infected persons are unaware of their infection, and many remain asymptomatic until onset of cirrhosis or end-stage liver disease.”
> “The USPSTF recommends screening for HBV infection in adolescents and adults at increased risk for infection. (B recommendation).”
Source: [US Preventive Services Task Force (2020)](https://pubmed.ncbi.nlm.nih.gov/33320230/)
###### Screening markers: EASL 2025 recommendation
> “For initial screening of HBV infection, HBsAg and anti-HBc should be determined (strong recommendation, consensus).”
> “Anti-HBs can provide valuable insights into vaccination status, particularly when both HBsAg and anti-HBc are negative, and can aid in risk stratification for HBVr in patients undergoing immunosuppressive treatment.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Initial virologic evaluation of HBsAg-positive persons: HBeAg and HBV DNA
> “After identifying a person with HBV infection, testing for HBeAg, anti-HBe, and HBV DNA can provide information on the level of viral replication and infectivity and help guide clinical management.”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
> “HBV DNA should be tested, as it serves as the most important prognostic marker and is critical for treatment indication and treatment monitoring”
> “HBsAg quantification should be tested to characterize disease phase, define prognosis and guide treatment”
> “HBeAg should be tested to define the disease phase”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Quantitative HBsAg: assays, thresholds, and role in phase classification and treatment endpoints
> “Quantitative HBsAg cannot replace HBV DNA measurement but can provide additional value, such as helping to differentiate the phases of chronic HBV infection (see Table 4) and guiding treatment.”
> “HBsAg levels should be determined every 12 months. If a quantitative determination of HBsAg is not possible, a qualitative HBsAg test is the minimum requirement (strong recommendation, strong consensus).”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
> “The desire to assess covalently closed circular DNA (cccDNA) inside hepatocytes led to development of reproducible, automated, and standardized (IU/mL) assays (Architect QT assay [Abbott], Elecsys HBsAg III Quant [Roche], Liaison XL [DiaSorin]) to quantify hepatitis B surface antigen (109).”
> “Although qHBsAg reflects covalently closed circular DNA and intrahepatic DNA levels, it also measures HBsAg that arises from integrated DNA, thereby reducing its specificity as a biomarker for viral replication.”
> “In HBeAg-negative patients, low qHBsAg (<1,000 IU/mL) and low HBV DNA (≤2,000 IU/mL) suggest inactive CHB.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Assessment of fibrosis and cirrhosis: noninvasive methods and liver stiffness thresholds
> “Non-invasive methods should be used to assess liver fibrosis and stage liver disease in all HBsAg-positive individuals (strong recommendation, strong consensus).”
> “In an optimal setting, liver fibrosis is assessed using LSM, with defined cut-off values for VCTE indicating significant fibrosis (7.2-7.9 kPa), advanced fibrosis (8.8-9.4 kPa) and cirrhosis (≥11.7-12.2 kPa), as shown in two systematic reviews and meta-analyses focused on individuals with HBV infection.”
> “Liver stiffness values <10 kPa were proposed as a safe cut-off for excluding cACLD and values >15 kPa as highly suggestive of cACLD.”
> “Serum-based tests such as APRI and FIB-4 are widely available, but their accuracy in chronic HBV infection is limited.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
> “Elastography (e.g., FibroScan) or serum fibrosis assessment (e.g., APRI, FibroSure, FIB-4)”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
> “Alternative methods to assess fibrosis are elastography (preferred) and liver fibrosis biomarkers (eg, FIB-4 or FibroTest®).”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Bepirovirsen patient selection: quantitative HBsAg testing and the FDA-authorized companion diagnostic
> “Prior to initiation of HIBSAGO for treatment of chronic HBV infection, test all patients to quantify HBsAg levels in serum or plasma to identify patients with baseline HBsAg levels less than or equal to 3,000 IU/mL”
> “Information on FDA-authorized tests for the quantification of HBsAg levels is available at:”
> “rule out cirrhosis before initiating HIBSAGO”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “The FDA also authorized the Roche Elecsys HBsAg II quant II RxDx assay as a companion diagnostic device to aid in the selection of patients with chronic HBV infection for treatment with antiviral therapy in accordance with the FDA approved drug labeling and to assist in monitoring patients throughout the course of treatment.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
> “Quantitative surface antigen testing will support the diagnosis and identification of patients suitable for treatment with bepirovirsen who have baseline HBsAg levels ≤3000 IU/ml. Several tests are available, including a recently authorised FDA test.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
##### 2.2.1.6 Clinical Presentation - Signs and Symptoms
###### Asymptomatic chronic infection: no symptoms until advanced liver disease in most persons
> “Most people with chronic HBV infection are asymptomatic and have no evidence of liver disease or injury. However, some people develop chronic hepatitis (elevation of aspartate aminotransferase [AST]/alanine aminotransferase [ALT]), cirrhosis, or hepatocellular carcinoma (i.e., primary liver cancer).”
Source: [CDC Clinical Signs and Symptoms of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-signs/index.html)
> “Some reasons for these low rates of surveillance, diagnosis, and treatment include the asymptomatic nature of chronic hepatitis B until the very late stages, a lack of curative therapy with a finite treatment duration, a complex natural history, and a lack of knowledge about the disease by both care providers and patients.”
> “Once treatment is initiated, adherence to treatment is often poor due to the asymptomatic nature of CHB during the pre-end-stage liver disease period.”
Source: [Nguyen et al. (2020)](https://pmc.ncbi.nlm.nih.gov/articles/PMC7048015/)
> “Transition from the immune-tolerant to immune active phase of CHB is usually asymptomatic. Therefore, individuals in the immune-tolerant phase not on antiviral therapy require regular laboratory testing to assess transition to the immune active phase of CHB.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Acute hepatitis symptoms: jaundice, fatigue, abdominal pain, and dark urine
> “When present, signs and symptoms for acute hepatitis B appear an average of 90 days after exposure, but range from 60–150 days”
> “Abdominal pain, nausea, and/or vomiting”
> “Dark urine or clay-colored stools”
> “Fatigue”
> “Fever”
> “Jaundice”
> “Joint pain”
> “Loss of appetite”
> “People aged 5 years and older develop symptoms in 30%–50% of cases.”
> “People younger than 30 years old are less likely to be symptomatic compared with people 30 years and older.”
Source: [CDC Clinical Signs and Symptoms of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-signs/index.html)
> “Acute HBV infection is often asymptomatic but can lead to severe hepatitis and, in some adult cases, to fulminant hepatitis and liver failure.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Hepatic flares: aminotransferase elevations during chronic infection and after antiviral withdrawal
> “Hepatitis flare: ALT increase ≥3 times baseline and >100 U/L”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “HBsAg-positive, HBeAg-negative adults without evidence of cirrhosis in the indeterminate phase are at risk of hepatitis flares, cirrhosis, hepatic decompensation, and HCC though the range in risk is wide.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “A systematic review and meta-analysis assessed the risk of severe clinical events after discontinuing NA therapy, finding that 1.21% of patients experienced severe hepatitis flares or hepatic decompensation, with significantly higher risks in patients with cirrhosis (3.63%) and a 0.37% chance of flare-related death or liver transplantation.”
> “While flare severity may decrease over time, late ALT flares, though less frequent, can still be clinically significant, with ALT levels reaching ∼10× ULN. Physicians should remain vigilant for signs of hepatic decompensation or liver dysfunction.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Hepatic decompensation: variceal bleeding, ascites, hepatic encephalopathy, and hepatorenal syndrome
> “No history of cirrhosis, any hepatic decompensation (variceal bleed, ascites, hepatic encephalopathy, hepatorenal syndrome), HCC or extrahepatic complications of HBV”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “HBV-associated liver failure is reasonably defined as 1 of the following: (i) impaired synthetic function (total bilirubin >3 mg/dL or international normalized ratio >1.5), (ii) ascites, (iii) encephalopathy, or (iv) death following HBV-associated liver failure due to HBV reactivation.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “The Baveno VI consensus introduced the term “compensated advanced chronic liver disease (cACLD)” to describe patients with advanced fibrosis or early cirrhosis who remain asymptomatic but are at risk of developing clinically significant portal hypertension (CSPH) and disease progression.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Liver cancer: late presentation
> “In low-income settings, most people with liver cancer present late in the course of the disease and die within months of diagnosis. In high-income countries, patients present to hospital earlier in the course of the disease and have access to surgery and chemotherapy, which can prolong life for several months to a few years.”
Source: [WHO hepatitis B fact sheet (2026)](https://www.who.int/news-room/fact-sheets/detail/hepatitis-b)
###### Extrahepatic manifestations: vasculitis, glomerulopathy, arthritis, and lymphoma
> “HBV infection can lead to extrahepatic manifestations such as mixed cryoglobulinemia vasculitis, serum sickness-like syndrome, non-rheumatoid arthritis, rheumatoid arthritis, panarteritis nodosa, glomerulopathies, or non-Hodgkin lymphoma that influence morbidity, quality of life, and mortality.144–147 However, the frequency of extrahepatic manifestations in HBV infection is considerably lower than that observed in HCV infections.”
> “Extrahepatic manifestations have been documented in HBeAg-positive individuals236–239 and this should be an indication for treatment regardless of the ALT level, especially as the treatment of extrahepatic manifestations usually requires additional immunosuppressive therapy.”
> “Extrahepatic manifestations have rarely been documented in HBeAg-negative infections,250 but if suspected, they should lead to treatment, especially since additional immunosuppressive treatment is usually required.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
##### 2.2.1.7 Long-term Morbidity
###### Chronic liver disease in 15% to 25% of persons with chronic infection
> “Approximately 15%–25% of people with chronic infection develop chronic liver disease, including cirrhosis, liver failure, or liver cancer.”
Source: [CDC Clinical Overview of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-overview/index.html)
> “Chronic HBV infection is a significant risk factor for the development of cirrhosis, end-stage liver disease, and HCC, and it may also be associated with extrahepatic manifestations.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Cirrhosis, decompensation, and survival
> “The cumulative incidence of cirrhosis increased with the HBV-DNA level”
> “Patients with cirrhosis are estimated to progress to decompensated cirrhosis at a rate of 3% annually.13 In cirrhotic patients, the presence of HBeAg (reflecting active viral replication) increases the risk for liver decompensation.14 The 5-year survival rate is 84% among compensated cirrhosis patients and 14%–28% in decompensated cirrhosis patients.”
Source: [Iloeje et al. (2006)](https://doi.org/10.1053/j.gastro.2005.11.016)
###### Hepatocellular carcinoma: viral load as a risk factor
> “Elevated serum HBV DNA level (≥10 000 copies/mL) is a strong risk predictor of hepatocellular carcinoma independent of HBeAg, serum alanine aminotransferase level, and liver cirrhosis.”
Source: [Chen et al. (2006)](https://doi.org/10.1001/jama.295.1.65)
> “HBV DNA >2,000 IU/ml is associated with an increased risk of developing liver cirrhosis, end-stage liver disease and HCC.109,110 The relationship between serum HBV DNA level and HCC risk is a non-linear dose-response relationship, with a more significant increase in HCC risk at serum HBV DNA levels >200,000 IU/ml compared to the risk observed between 2,000 IU/ml and 200,000 IU/ml, while the risk is very low at levels <2,000 IU/ml.”
> “An HBsAg level of ≥1,000 IU/ml was associated with an increased risk of HCC in both HBeAg-negative individuals with HBV DNA <2,000 IU/ml and those with HBV DNA between 2,000 and 20,000 IU/ml.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Residual cirrhosis and hepatocellular carcinoma risk on antiviral therapy in non-cirrhotic U.S. Veterans
> “Among 2,496 patients with non-cirrhotic CHB (39.1% African American, 38.4% non-Hispanic White, 18.8% Asian, mean age 58.0 ± 13.4 years), the overall incidences of cirrhosis and HCC were 3.99 per 100 person-years (95% CI 3.66-4.35) and 0.43 per 100 person-years (95% CI 0.33-0.54), respectively. The highest incidences of cirrhosis and HCC were observed in non-Hispanic White patients (5.74 and 0.52 per 100 person-years, respectively), which were significantly higher than in Asian patients (1.93 and 0.17 per 100 person-years, respectively, p <0.0001).”
Source: [Yang et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10494462/)
###### Residual hepatocellular carcinoma risk beyond 10 years of entecavir or tenofovir
> “Of 1,644 patients, 903 were followed beyond year 10 (mean:14 ± 2 years). The 10- and 15-year cumulative incidences of HCC were 10.9% and 13.2%, respectively. The HCC IR was 1.25 before year 10 and 0.55/100 PYs after year 10 (p <0.001), with similar findings after inverse probability weighting.”
> “Despite >10 years of NA therapy, patients with CHB remain at risk of HCC, although the incidence rate declines significantly. HCC remains the main determinant of mortality.”
Source: [Papatheodoridis et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42409322/)
> “HCC risk remains after viral suppression”
> “In patients without cirrhosis, longitudinal studies have also shown that long-term viral suppression reduces the risk of HCC,118,119 but the evidence in this case is less conclusive, mainly due to short follow-up and the low incidence rate in this setting.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Residual hepatocellular carcinoma risk after HBsAg loss
> “For individuals who have cleared HBsAg, one study reported an annual HCC incidence of 0.86% overall, 2.42% in those with cirrhosis, 0.43% in those without cirrhosis, 1.07% for males, 0.57% for females, 1.21% if ≥50 years, and 0.33% if <50 years,113 while another reported a rate of 0.4% for males and 0% for females without cirrhosis.114 In a meta-analysis of 24 studies of 33,838 persons who cleared HBsAg, the pooled proportions of HCC occurrence ranged from 0.35% to 0.78% per year following treatment-induced or spontaneous HBsAg loss, respectively.”
> “Taken together, following HBsAg loss whether spontaneous or with antiviral therapy, significant HCC risk remains for those with established cirrhosis and for those without cirrhosis who were 45-50 years or older at the time of HBsAg loss.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “Patients who experienced HBsAg seroclearance had significantly lower HCC incidence than HBsAg‐positive (RR = 0.41, p < .001). The pooled HCC incidence after HBsAg seroclearance was 1.88%; this rate was reduced to 0.76% among patients without baseline cirrhosis.”
> “The results showed that HBsAg seroclearance was durable, with a pooled recurrence rate of 6.19% (95% CI: 4.10%–8.68%).”
Source: [Song et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC7986681/)
> “Although progression of liver disease to cirrhosis or hepatic decompensation generally stops when patients lose HBsAg unless other causes of liver injury are present (eg, heavy alcohol consumption or nonalcoholic fatty liver), the risk of HCC persists, particularly if HBsAg loss occurred in patients older than 50 years or in those with cirrhosis or coinfection with HCV or hepatitis D virus (HDV) (128, 130–132).”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “A systematic review also showed that HBsAg loss correlates with lower rates of incident cirrhosis, hepatic decompensation, and overall and liver-related mortality, though there was substantial heterogeneity across studies for all outcomes.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Liver transplantation and end-stage outcomes among U.S. decedents with chronic hepatitis B
> “Compared to survivors, decedents were older, more likely to be White (40.6%), African-American (27.1%), or male (74.2%); and more likely to have had cirrhosis (59.8%), diabetes (27.2%), alcohol abuse (17.7%), hepatocellular carcinoma (17.5%), or a liver transplant (5.7%); whereas survivors were more likely to be Asian (48.8%; all P < .001).”
Source: [Bixler et al. (2019)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11230463/)
> “The IR of death or LT was lower before vs. after year 10 (1.50 vs. 1.95/100 PYs, p = 0.069), whereas the IR was similar for liver-related death/LT between the two periods (0.74 vs. 0.70/100 PYs, p = 0.840).”
Source: [Papatheodoridis et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42409322/)
###### Projected U.S. decompensated cirrhosis and hepatocellular carcinoma, 2019 to 2030
> “New decompensated cirrhosis, hepatocellular carcinoma, and liver related deaths are expected to increase by 20%, 31% and 25% respectively from 2019 to 2030 at current diagnosis and treatment rate.”
Source: [Razavi-Shearer et al. (2023a)](https://pmc.ncbi.nlm.nih.gov/articles/PMC10239007/)
###### Hepatitis D coinfection: prevalence and hepatocellular carcinoma risk in the United States
> “A total of 6719 patients were diagnosed with HBV/HDV among 144,975 with HBV and 12 months of continuous data, for a prevalence of 4.6%. At diagnosis, 31.7% of patients with HBV/HDV had advanced liver complications, including compensated cirrhosis (16.3%) and decompensated cirrhosis (10.4%).”
Source: [Gish et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11020024/)
> “For persons with HDV co-infection, a U.S. study of 4817 persons with HBV including 158 with HDV found an HCC incidence per 1,000 person-years of 18.65 in HBV/HDV versus 4.84 in HBV mono-infected individuals.115 The large majority of both mono-infected (92.3%) and co-infected (87.3%) participants in this study did not have cirrhosis.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Extrahepatic disease: immune-complex manifestations and extrahepatic malignancies
> “Antiviral therapy not only prevents disease progression but also helps reduce transmission, improve extrahepatic manifestations, and lower the risk of viral reactivation. Additionally, chronic HBV infection has been associated with a higher risk of developing extrahepatic malignancies.”
> “Immunomodulatory and immunosuppressive agents (such as high-dose IgG, rituximab, high-dose corticosteroids and plasmapheresis) are usually required (in addition to antiviral therapy) to treat the major renal, neurologic and haematologic manifestations observed.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
##### 2.2.1.8 Burden of Chronic hepatitis B virus infection in adults without cirrhosis
###### 2.2.1.8.1 Humanistic Burden and Health-related Quality of Life
###### Utility values by disease stage: global meta-analysis of 19 studies with 10,311 patients
> “Twenty-two articles from 19 studies, comprising 10,311 patients, were included. Of these studies, 74% were performed in the Western Pacific Region, and 47% used the EuroQoL-5D-3L instrument. HRQOL was found to decrease with advancing stages of HBV-related disease.”
> “Meta-regression showed the following predicted mean utility scores for the different stages of chronic HBV infection: non-cirrhotic, 0.842; compensated cirrhosis, 0.820 ( p = 0.474 compared with non-cirrhotic); decompensated cirrhosis, 0.722 ( p = 0.001); and hepatocellular carcinoma, 0.749 ( p = 0.008).”
> “Chronic HBV infection impairs the HRQOL of patients, even when there is no evidence of cirrhosis. HRQOL is particularly impaired in the advanced stages of decompensated cirrhosis and hepatocellular carcinoma.”
Source: [Fu et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11919624/)
###### Utility values by disease stage in the United States, Europe, Canada, Australia, and New Zealand: meta-analysis of chronic hepatitis B studies
> “Electronic databases were searched from inception to May 2023 to identify primary studies reporting health-state utilities in English in patients aged 18 years and over, with cHBV, cHCV, or cHDV in the United States, the United Kingdom, Europe, Canada, Australia, or New Zealand.”
> “More studies meeting the inclusion criteria reported utilities for cHCV (n = 20) than for cHBV (n = 8); no studies reported utility values for cHDV.”
> “Utilities decreased with disease progression from NC (EQ-5D-3L: 0.90; any instrument: 0.85) to cirrhotic health states (0.35-0.88); however, given the mixed findings for progression from DC to HCC, utilities were higher for HCC (any instrument: 0.49) than DC (any instrument: 0.35)”
Source: [Kaushik et al. (2024)](https://doi.org/10.1016/j.jval.2024.06.002)
| Health state (chronic hepatitis B, any instrument) | Mean utility | 95% CI |
| --- | --- | --- |
| Noncirrhotic (F0-F3) | “0.84” | “0.78-0.90” |
| Compensated cirrhosis (F4) | “0.77” | “0.65-0.89” |
| Decompensated cirrhosis | “0.35” | “0.31-0.40” |
| Hepatocellular carcinoma | “0.49” | “0.23-0.75” |
| Post liver transplantation, year 1 | “0.57” | “0.51-0.62” |
| Post liver transplantation, year 2 and later | “0.67” | “0.62-0.72” |
Source: [Kaushik et al. (2024)](https://doi.org/10.1016/j.jval.2024.06.002)
###### Standard gamble utilities from infected and uninfected respondents in six jurisdictions, including the United States
> “Standard gamble utilities were elicited from hepatitis patients and uninfected respondents using an interviewer-administered survey in the United States, Canada, United Kingdom, Spain, Hong Kong, and mainland China.”
> “The sample included 534 CHB-infected patients and 600 uninfected respondents. CHB and compensated cirrhosis had a moderate impact on HRQOL with utilities ranging from 0.68 to 0.80. Decompensated cirrhosis and hepatocellular carcinoma had a stronger impact with utilities ranging from 0.35 to 0.41.”
> “Significant variation was observed between countries, with both types of respondents in mainland China and Hong Kong reporting systematically lower utilities.”
Source: [Levy et al. (2008)](https://pubmed.ncbi.nlm.nih.gov/18179664/)
###### Patient-reported outcomes and viral suppression in 242 phase 2 trial participants without advanced fibrosis or cirrhosis
> “We collected and analyzed PRO data from 242 patients with chronic HBV infection (without advanced fibrosis or cirrhosis) enrolled in 2 international phase 2 blinded controlled clinical trials from 2015 through 2017.”
> “At baseline, patients with viral suppression (HBV DNA level, <20 IU/mL) had higher PRO scores (by up to +10.6% of a PRO range size).”
> “In multivariate analysis, a reduction in viral load was independently associated with increases in PROs (β values up to 1.6% per log10 IU/mL decrease; P < .05).”
Source: [Younossi et al. (2018)](https://pubmed.ncbi.nlm.nih.gov/29505905/)
###### Fatigue, patient-reported outcomes, and work productivity in 1561 registry participants with chronic hepatitis B from 14 countries
> “Among 2888 patients from 14 countries, 1561 had CHB (mean age 47 ± 13 years; 60% male; 13% advanced fibrosis; 13% depression; 17% fatigue)”
> “CHB-fatigue was associated with younger age, female, obesity, anxiety, depression (all p < 0.01) and worse PRO scores: CLDQ (scale 1-7): 4.1 ± 0.9 vs. 5.8 ± 0.9; FACIT score (range 0-108): 67.6 ± 14.5 vs. 87.7 ± 13.7; work productivity impairment (range 0-1): 0.33 ± 0.29 vs. 0.11 ± 0.22 (all p < 0.0001).”
Source: [Yilmaz et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42144799/)
###### Depressive and anxiety symptoms: meta-analysis of 31 studies
> “We identified a high prevalence of depressive symptoms (Proportion=19%, 95% CI: 11-31) and anxiety (Proportion=30%, 95% CI: 18-45) among individuals with hepatitis B. There was also a significantly increased risk of depressive symptoms (RR=1.45, 95% CI: 1.00-2.09, P=0.049) and anxiety (RR=1.40, 95% CI: 1.11-1.78) in individuals with hepatitis B compared to controls.”
> “Subgroup analyses indicated that older age and chronic hepatitis B infection were associated with a higher prevalence of anxiety and depressive symptoms.”
Source: [Low et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11973283/)
###### Qualitative health-related quality of life interviews with 19 adults in the United States
> “A sample of 19 individuals living with chronic HBV were included within this study.”
> “The psychological impact of chronic HBV on study participants’ HRQL overall was considerable and contributed to depression, anxiety, homelessness, drug use, and incarceration.”
> “Our analysis supports the hypothesis that HBV impacts HRQL and often negatively affects emotional health.”
Source: [Freeland et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8581088/)
###### Stigma: systematic review of 23 studies
> “A total of 23 (17 quantitative and 6 qualitative) articles examined HBV-related stigma.”
> “Some people also perceived structural/institutional stigma, with up to 20% believing that they may be denied healthcare and up to 30% stating they may experience workplace discrimination due to HBV.”
> “HBV-related stigma is common, particularly in some countries in Southeast Asia and the Western Pacific region and among Asian immigrant communities, but is poorly characterized in non-Asian populations.”
Source: [Smith-Palmer et al. (2020)](https://pmc.ncbi.nlm.nih.gov/articles/PMC7082540/)
###### Discrimination: global registry of 569 respondents from 65 countries
> “A total of 569 individuals responded to the survey between May 2021 and December 2023.”
> “Of these, 461 individuals shared details about their experiences of discrimination with most relating to restrictions on access to work visas, followed by in-country hepatitis B-related employment restrictions, educational-based discrimination, discrimination within the community and health facilities, and the emotional impact of hepatitis B discrimination.”
Source: [Freeland et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11167835/)
###### 2.2.1.8.2 Economic Burden and Healthcare Resource Utilization
###### Annual all-cause healthcare costs by disease severity: U.S. Commercial, Medicare, and Medicaid claims, 2004 to 2015
> “Using Commercial, Medicare, and Medicaid databases from 2004 to 2015 and ICD9 codes, we retrospectively identified adults with CHB, analyzing all-cause inpatient, outpatient, and pharmaceutical utilization and costs by disease severity.”
> “Our sample consisted of 33,904 CHB cases and 86,072 non-CHB controls.”
> “Total mean all-cause annual healthcare costs were highest in patients with decompensated cirrhosis, HCC or receiving liver transplant compared to patients with CLD across insurance types (all p <0.05 except Medicare HCC) (Fig. 1), (e.g., for Commercial: $142,870, $124,123 and $171,851 vs. $18,619, respectively).”
> “Specifically, for the non-cirrhotic or compensated cirrhotic patients their costs ranged from $1,393 to $2,609 (dependent on payer group) compared to $30,849 to $130,139 for those with a history of liver transplant and again dependent on payer group (all p <0.05) (Fig. 3).”
> “However, even patients with CLD had three times the annual healthcare cost of matched non-CHB controls across payers (all p <0.05) (Fig. 4).”
> “Compensated liver disease: 98% non-cirrhotic CHB; 2% compensated cirrhosis.”
Source: [Nguyen et al. (2019)](https://doi.org/10.1016/j.jhep.2018.09.021)
###### Inpatient cost share and inpatient use by disease severity in the same claims study
> “The largest all-cause cost components for Commercial and Medicaid were inpatient costs for all advanced liver disease groups (Commercial: 62%, 47%, 68%; Medicaid: 81%, 72%, 74%, respectively), and decompensated cirrhosis and hepatocellular carcinoma groups for Medicare (Medicare 49% and 48%).”
> “Average inpatient length of stay was also highest in decompensated cirrhosis and liver transplantation (Commercial 8.3 and 10.8 days, Medicaid 9.3 and 7.4 days, Medicare 7.3 and 5.8 days, respectively) (Table 3).”
> “Across all payers, patients with decompensated cirrhosis had the highest emergency department utilization (1.6–2.8 annual visits) and highest mean annual costs.”
Source: [Nguyen et al. (2019)](https://doi.org/10.1016/j.jhep.2018.09.021)
###### Inpatient costs of hospitalizations with chronic hepatitis B: National Inpatient Sample, 2016 to 2019
> “The 2016–2019 National Inpatient Sample was used to select individuals diagnosed with CHB.”
> “From 2016 to 2019, the total costs of hospitalizations in CHB patients were $603.82, $737.92, $758.29, and $809.01 million dollars from 2016 to 2019, respectively.”
> “We did not observe significant cost trends in the composite CHB population or in the cirrhosis and non-cirrhosis cohorts.”
Source: [Lee et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11257816/)
###### Medicare beneficiaries with chronic hepatitis B: outcomes and charges, 2005 to 2014
> “Study cohort included 18,603 Medicare recipients with CH-B. Between 2005 and 2014, number of Medicare beneficiaries with CH-B increased by 4.4% annually.”
> “Furthermore, 7.4% of CH-B Medicare cohort experienced decompensated cirrhosis, 2.9% hepatocellular carcinoma (HCC) and 11.9% 1-year mortality.”
> “Annual total inpatient charges increased from $66,610 to $94,221 while these charges for outpatient increased from $9257 to $47,863.”
Source: [Kim et al. (2019)](https://pubmed.ncbi.nlm.nih.gov/30106839/)
###### Veterans Health Administration: total costs and nucleos(t)ide analogue persistence
> “Among patients treated with NAs ( N = 2368), 1428 (60%) were CHB mono-infected and 748 (32%) were HIV co-infected. Total costs per patient per year (PPPY) were $39,240, $29,957, and $55,220 PPPY for NA-treated, mono-infected, and HIV co-infected patients, respectively.”
> “Persistence among the inception cohort was 29% for first year and 14% for first 2 years.”
Source: [Sbarigia et al. (2020)](https://pmc.ncbi.nlm.nih.gov/articles/PMC7089729/)
###### Medicaid spending on nucleos(t)ide analogues, 2012 to 2021
> “Over the study period, 1.9 billion USD was spent on NA, with spending peaking in 2016 at $289 million US, which has subsequently decreased. Lower expenditures since 2016 have been associated with increased use of generics. The use of generic tenofovir or entecavir led to savings of $669 million US over the study period.”
Source: [Congly et al. (2024)](https://pubmed.ncbi.nlm.nih.gov/38710472/)
###### Average wholesale prices of nucleos(t)ide analogues: Vermont prescriber price disclosure, January 2024
> “The prices listed below are Average Wholesale Prices”
> “The price paid by consumers may be higher or lower than the prices listed below.”
> “Wholesale Acquisition Cost (WAC) plus 20%”
> “Source: First Databank, 01/28/2024.”
Source: [Gilead Sciences (2024)](https://www.gilead.com/-/media/files/pdfs/other/vemlidy-long-form.pdf)
| Product | Labeler as listed | Package | Package price (AWP) | Unit price (AWP) |
| --- | --- | --- | --- | --- |
| Tenofovir alafenamide 25 mg tablet (Vemlidy) | “Gilead Sciences” | “30 EA” | “$1,729.91” | “$57.66” |
| Entecavir 0.5 mg tablet (Baraclude) | “Bms Primarycare” | “30 EA” | “$1,646.98” | “$54.90” |
| Entecavir 0.5 mg tablet, generic, lowest listed | “Epic Pharma Llc” | “30 EA” | “$9.60” | “$0.32” |
| Entecavir 0.5 mg tablet, generic | “Camber Pharmace” | “30 EA” | “$48.00” | “$1.60” |
| Entecavir 0.5 mg tablet, generic, highest listed | “Marlex Pharm.” | “30 EA” | “$864.00” | “$28.80” |
| Adefovir dipivoxil 10 mg tablet, generic | “Apotex Corp” | “30 EA” | “$1,074.00” | “$35.80” |
Source: [Gilead Sciences (2024)](https://www.gilead.com/-/media/files/pdfs/other/vemlidy-long-form.pdf)
###### Annual antiviral drug and monitoring cost inputs in a U.S. cost-effectiveness model (2021 U.S. dollars)
> “Although the lowest price for antiviral drugs is generic tenofovir disoproxil fumarate at $325 per year”
> “we used an annual antiviral drug cost of $502 with the assumption that 60% of the patients will be dispensed generic tenofovir disoproxil fumarate and 40% generic entecavir.”
> “we assumed that they will receive initial baseline tests (hepatitis B e antigen, complete blood count, complete metabolic panel, HBV DNA), and twice yearly clinic visits with alanine aminotransferase blood tests and yearly HBV DNA viral load tests, and that eligible patients (50%) would receive additional hepatocellular carcinoma surveillance consisting of liver ultrasound and α-fetoprotein every 6 months”
Source: [Hutton et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9188991/)
###### Annual medical management costs by disease stage used in a U.S. hepatitis D testing cost-effectiveness model (2024 U.S. dollars)
| Health state | Base value | Range |
| --- | --- | --- |
| Cirrhosis | “$5964” | “$202–$7096” |
| Decompensated cirrhosis | “$15 795” | “$4901–$37 081” |
| Liver transplantation, first year | “$215 162” | “$167 163–$250 746” |
| Liver transplantation, second year | “$26 860” | “$23 958–$35 937” |
Source: [Toy et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12598672/)
###### Projected U.S. direct medical costs, diagnosed population, and treated population: PRoGReSs model, 2020 to 2050
> “Based on recent data, it was estimated that there are 300,000 individuals diagnosed with chronic hepatitis B in the US, 13,900 chronic cases diagnosed annually, and 143,500 individuals on antiviral treatment.”
> “Annual costs for HBV medication under the base scenario were estimated at $5382 ($362–$12,310) based on drug sales data.”
> “The net prices of HBV medicine in the US are not publicly available.”
> “Between 2020 and 2050, it was projected that the United States would spend $44,822 million (40,920–51,994 million) cumulatively in direct medical costs associated with HBV.”
Source: [Razavi-Shearer et al. (2023b)](https://doi.org/10.1111/jvh.13843)
###### 2.2.1.8.3 Economic Impact of Chronic hepatitis B virus infection in adults without cirrhosis on Families
###### Caregiver or household cost studies in U.S. adults with chronic hepatitis B
No evidence found.
###### Patient out-of-pocket and productivity costs of liver cancer surveillance: U.S. insured adults without cirrhosis
> “Of 6831 patients (1122 on antiviral treatment, 5709 untreated), only 39.3% and 51.3% had received any abdominal imaging after 6 and 12 months, respectively, and patients were up to date with HCC surveillance guidelines for only 28% of the follow‐up time.”
> “Mean total and patient‐paid daily surveillance‐related costs ranged from $99 (ultrasound) to $334 (magnetic resonance imaging), and mean annual patient costs due to lost productivity for surveillance‐related outpatient visits ranged from $93 (using the federal minimum wage) to $321 (using the Bureau of Labor Statistics wage).”
> “Total and patient‐paid mean daily costs of outpatient surveillance were highest for MRI only ($1717 and $334, respectively) and lowest for ultrasound only ($415 and $99, respectively)”
Source: [Nguyen et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9701467/)
###### 2.2.1.8.4 Economic Impact of Diagnostic Testing
###### Quantitative HBsAg testing required for patient selection
> “Prior to initiation of HIBSAGO for treatment of chronic HBV infection, test all patients to quantify HBsAg levels in serum or plasma to identify patients with baseline HBsAg levels less than or equal to 3,000 IU/mL”
> “In addition, test patients for HBV DNA, ALT, AST, bilirubin, platelet count, urine albumin-creatinine ratio (uACR), and estimated glomerular filtration rate (eGFR) prior to initiation of treatment and as directed while on treatment and following treatment completion”
> “Information on FDA-authorized tests for the quantification of HBsAg levels is available at:”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Minimum on-treatment laboratory monitoring required by the prescribing information
> “HIBSAGO therapy should be prescribed only when appropriate laboratory monitoring can be performed to manage the treatment regimen.”
> “Weekly through Week 12 and every other week from Weeks 12 through 24”
> “The minimum recommended on-treatment monitoring of ALT and total bilirubin in all patients.”
> “The minimum recommended on-treatment monitoring of platelet counts in all patients.”
> “Monitor eGFR every other week through Week 24”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Availability of quantitative HBsAg tests at approval
> “Quantitative surface antigen testing will support the diagnosis and identification of patients suitable for treatment with bepirovirsen who have baseline HBsAg levels ≤3000 IU/ml. Several tests are available, including a recently authorised FDA test.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Medicare reimbursement for hepatitis B laboratory tests used in a U.S. hepatitis D testing cost-effectiveness model (2024 U.S. dollars)
| Test or service | Unit cost and frequency over 48 weeks of treatment | Cost basis |
| --- | --- | --- |
| HBV DNA test | “$59 × 4” | “Medicare reimbursement” |
| HBsAg test | “$10.33 × 4” | “Medicare reimbursement” |
| LFT and CBC with platelet count | “$86.74 × 4” | “Medicare reimbursement” |
| Comprehensive metabolic panel | “$10.56 × 4” | “Medicare reimbursement” |
| Clinic visits | “$74 × 8” | “Medicare reimbursement” |
Source: [Toy et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12598672/)
###### Medicare reimbursement for hepatitis B serology tests used in a U.S. testing cost-effectiveness model
> “The costs of HBsAg ($10.33), anti-HBc ($10.74), anti-HBs ($12.05) tests, and a 3 HepB tests package ($28.27) were based on Medicare reimbursement.”
Source: [Hutton et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9188991/)
###### Cost-effectiveness of one-time universal HBsAg screening of U.S. adults
> “At an estimated 0.24% prevalence of undiagnosed CHB, universal hepatitis B surface antigen (HBsAg) screening in adults aged 18-69 years is cost-saving compared with current practice if antiviral treatment drug costs remain below $894/year.”
> “Compared with current practice, universal screening would avert an additional 7.4 cases of compensated cirrhosis, 3.3 cases of decompensated cirrhosis, 5.5 cases of hepatocellular carcinoma, 1.9 liver transplants, and 10.3 hepatitis B virus-related deaths at a saving of $263 000/100 000 adults screened.”
> “Testing costs were based on Medicare reimbursement rates.”
Source: [Toy et al. (2022a)](https://pubmed.ncbi.nlm.nih.gov/33956937/)
###### Cost-effectiveness of one-time HBV testing at vaccination in adults seeking care for sexually transmitted infection
> “Compared with current recommendations, the addition of 1-time HBV testing is cost-saving and would prevent an additional 138 cases of cirrhosis, 47 cases of decompensated cirrhosis, 90 cases of hepatocellular carcinoma, 33 liver transplants, and 163 HBV-related deaths, and gain 2185 QALYs, per 100,000 adults screened.”
> “Screening with the 3-test panel would save $41.6 to $42.7 million per 100,000 adults tested compared with $41.5 to $42.5 million for the 2-test panel and $40.2 to $40.3 million for HBsAg alone.”
Source: [Hutton et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9188991/)
###### Reimbursement specific to quantitative HBsAg assays and to fibrosis assessment for excluding cirrhosis
No evidence found.
#### 2.2.2 Approaches to Treatment
##### 2.2.2.1 Current Treatment Options and Standard of Care
###### 2.2.2.1.1 Nucleos(t)ide Analogues
###### Preferred agents and selection criteria: AASLD/IDSA 2025 guideline
> “Two classes of drugs are approved for the treatment of CHB: peginterferon and nucleos(t)ide analogues (NAs).”
> “There are three NAs that are preferred for treatment of CHB: entecavir (ETV), tenofovir disoproxil fumarate (TDF), and tenofovir alafenamide (TAF). All 3 drugs provide high efficacy in achieving HBV DNA suppression, have low rates of antiviral resistance, and are well tolerated and broadly applicable (including for persons with decompensated cirrhosis and immunocompromised states).”
> “Selecting among these drugs is based upon availability/cost, age, presence of renal or bone disease (avoid TDF), pregnancy (avoid ETV), HIV coinfection (avoid ETV unless HIV RNA suppressed on antiretroviral regimen), and prior treatment history (avoid ETV if prior lamivudine exposure).”
> “TAF is not recommended if creatinine clearance is less than 15mL/min and not yet on dialysis.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Treatment goals and indications: AASLD/IDSA 2025 guideline
> “The goals of antiviral treatment are prevention of progression to cirrhosis, development of hepatocellular carcinoma (HCC) and liver-related death.”
> “If cirrhosis is present, persons should initiate antiviral therapy regardless of HBV DNA or ALT level.”
> “For HBeAg positive persons without cirrhosis, antiviral treatment is indicated for an ALT level ≥2 X ULN and HBV DNA ≥20,000 IU/mL.”
> “For HBeAg negative persons without cirrhosis, treatment is indicated for an ALT level ≥2 X ULN and HBV DNA ≥2,000 IU/mL.”
> “Treatment of these individuals has been shown to reduce the incidence of progression to cirrhosis, development of HCC, need for liver transplantation and HBV-related liver mortality.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Preferred initial therapy: AASLD 2018 guidance
> “The AASLD recommends antiviral therapy for adults with immune-active CHB (HBeAg negative or HBeAg positive) to decrease the risk of liver-related complications”
> “The AASLD recommends peg-IFN, entecavir, or tenofovir (TDF) as preferred initial therapy for adults with immune-active CHB”
> “TAF is also a preferred initial therapy for adults with immune-active CHB.”
> “Consider TAF or entecavir in patients with or at risk for renal dysfunction or bone disease.”
> “However, in recommending peg-IFN, tenofovir, and entecavir as preferred therapies, the most important factor considered was the lack resistance with long-term use.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### First-line nucleos(t)ide analogue therapy: EASL 2025 guideline
> “ETV, TDF, or TAF should be used as first-line NA therapy. When selecting between ETV, TDF and TAF, comorbidities (especially renal insufficiency and reduction in bone density) and concomitant circumstances (e.g. women of childbearing age, pregnancy, age) as well as previous therapies should be taken into account (LoE 1, strong recommendation, strong consensus).”
> “The virological response (HBV DNA “Patients with HBeAg-positive or HBeAg-negative chronic hepatitis B, HBV DNA level ≥2,000 IU/ml and elevated ALT (>ULN) and/or significant fibrosis should receive antiviral therapy (LoE 1, strong recommendation, strong consensus).”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Preferred regimens: WHO 2024 guideline
> “For all adults, adolescents and children (two years or older) for whom antiviral therapy is indicated, the nucleos(t)ide analogues that have a high genetic barrier to drug resistance – tenofovir disoproxil fumarate (TDF) or entecavir (ETV) are recommended as preferred regimens.”
> “Nucleos(t)ide analogues with a low genetic barrier to resistance (lamivudine, adefovir or telbivudine) can lead to drug resistance and are not recommended.”
Source: [WHO hepatitis B guidelines (2024)](https://iris.who.int/server/api/core/bitstreams/34470cc8-af90-4d7b-a949-ef27e5d0726f/content)
###### Efficacy in HBeAg-negative immune-active chronic hepatitis B: pivotal trial summary
| Outcome (HBeAg-negative, treatment-naive adults) | Peginterferon | Entecavir | Tenofovir disoproxil fumarate | Tenofovir alafenamide |
| --- | --- | --- | --- | --- |
| % HBV DNA suppression | “19 (<80 IU/mL)” | “90–91 (<50–60 IU/mL)” | “93 (<60 U/mL)” | “90 (<29 IU/mL)” |
| % Normalization ALT | “59” | “78–88” | “76” | “81” |
| % HBsAg loss | “4” | “0–1” | “0” | “<1” |
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### HBsAg seroclearance rate in untreated and treated cohorts: meta-analysis
> “We analyzed 34 published studies (with 42,588 patients, 303,754 person-years of follow-up, and 3194 HBsAg seroclearance events), including additional and updated aggregated data from 19 studies. The pooled annual rate of HBsAg seroclearance was 1.02% (95% CI, 0.79-1.27). Cumulative incidence rates were 4.03% at 5 years (95% CI, 2.49-5.93), 8.16% at 10 years (95% CI, 5.24-11.72), and 17.99% at 15 years (95% CI, 6.18-23.24).”
> “HBsAg seroclearance was not associated with HBV genotype or treatment history.”
> “Patients with chronic HBV infection should therefore be counseled on the need for lifelong treatment, and curative therapies are needed.”
Source: [Yeo et al. (2019)](https://pubmed.ncbi.nlm.nih.gov/30342034/)
###### Long-term tenofovir alafenamide: 8-year suppression and HBsAg loss
> “By year 8, 2%–3% of patients had achieved HBsAg loss with or without seroconversion (Table 2; Tables S1 and S2).”
> “Conversely, rates of HBsAg loss and seroconversion were low at 2%–3%, and quantitative HBsAg titres declined minimally over 8 years.”
> “No patients developed resistance to TAF.”
Source: [Buti et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11599788/)
###### Long-term outcomes on entecavir or tenofovir: PAGE-B cohort beyond 10 years
> “The long-term PAGE-B cohort included 1,644 Caucasian patients with CHB treated with entecavir or tenofovir.”
> “The 10- and 15-year cumulative incidences of HBsAg loss on NA(s) were 8.3% and 14.3%, respectively; the IR of HBsAg loss increased from 0.94 before year 10 to 1.42/100 PYs after year 10 (p = 0.025).”
> “NA therapy was discontinued in 125 (7.6%) patients who remained HBsAg positive.”
Source: [Papatheodoridis et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42409322/)
###### Clinical benefits of long-term viral suppression: EASL 2025 guideline
> “Sustained suppression of HBV DNA is associated with an improvement in liver histology. After 5 years of treatment with ETV or tenofovir, improvement in liver fibrosis was observed in most patients and there was even reversal of Ishak F5/6 fibrosis/cirrhosis in some patients.”
> “many studies with follow-up periods of around 5 years likely had insufficient duration and sample sizes to demonstrate a significant effect on preventing HCC and death.”
> “However, one retrospective study with a follow-up of 8 years showed that TDF was associated with an HCC risk reduction of 73% in patients without cirrhosis.”
> “Improvement of survival: multiple studies, as summarised in a meta-analysis, have demonstrated a 50% reduction in mortality in patients with cirrhosis achieving viral suppression on NA therapy.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### 2.2.2.1.2 Pegylated Interferon Alfa
###### Current role: AASLD/IDSA 2025 guideline
> “Peginterferon is rarely used, given its limitations of applicability, safety and tolerability, compared with NA therapy.”
> “Role of peginterferon add-on or switch therapy to NA as strategy to achieve functional cure”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Recommendations on administration, stopping rules, and add-on therapy: EASL 2025 guideline
> “Predictive factors should be used to guide the decision to initiate PEG-IFNα treatment. In addition, PEG-IFNα-associated side effects should be considered, and the patient's treatment preferences should be taken into account to support the decision-making process (LoE 2, strong recommendation, strong consensus).”
> “PEG-IFNα should be administered once a week, typically for a duration of 48 weeks. The dose of PEG-IFNα-2a should be 180 μg weekly (s.c.) (LoE 1, strong recommendation, strong consensus).”
> “Stopping rules should be considered based on the quantitative determinations of HBV DNA and HBsAg at treatment week 12 and 24 (LoE 2, strong recommendation, strong consensus).”
> “De novo combination therapy with PEG-IFNα and NAs cannot be generally recommended. PEG-IFNα as an add-on therapy can be considered in selected HBeAg-negative patients undergoing NA therapy with low HBsAg levels (LoE 2, weak recommendation, consensus).”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Patient selection and duration: AASLD 2018 guidance
> “Comorbidities: peg-IFN is contraindicated in persons with autoimmune disease, uncontrolled psychiatric disease, cytopenia, severe cardiac disease, uncontrolled seizures, and decompensated cirrhosis.”
> “For patients treated with peg-IFN, 48 weeks’ duration is used in most studies and is preferred. This treatment duration yields HBeAg seroconversion rates of 20% to 31% and sustained off-treatment HBV DNA suppression of <2,000 IU/mL in 65% of persons who achieve HBeAg to anti-HBe seroconversion. The combination of peg-IFN and NAs has not yielded higher rates of off-treatment serological or virological responses and is not recommended.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Differences between peginterferon and nucleos(t)ide analogue therapy
| Feature | ETV, tenofovir (TDF, TAF) | PEG-IFNα |
| --- | --- | --- |
| Strategy | “Preventing disease progression through persistent HBV suppression” | “Induction of an off-treatment response through finite treatment” |
| Administration | “Oral, once daily” | “Subcutaneous, once weekly” |
| Treatment duration | “Long-term” | “Finite (48 weeks)” |
| Side effects | “Very low” | “Moderate to high” |
| Contraindications | “Very few (e.g. ETV in pregnancy)” | “Numerous” |
| HBsAg loss | “Very low” | “Low, higher compared to NAs” |
| Risk of viral resistance | “Very low” | “Absent” |
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### HBsAg loss with peginterferon monotherapy: HBeAg-negative pivotal trial
> “We compared the efficacy and safety of peginterferon alfa-2a (180 microg once weekly) plus placebo, peginterferon alfa-2a plus lamivudine (100 mg daily), and lamivudine alone in 177, 179, and 181 patients with HBeAg-negative chronic hepatitis B, respectively. Patients were treated for 48 weeks and followed for an additional 24 weeks.”
> “Loss of hepatitis B surface antigen occurred in 12 patients in the peginterferon groups, as compared with 0 patients in the group given lamivudine alone.”
Source: [Marcellin et al. (2004)](https://pubmed.ncbi.nlm.nih.gov/15371578/)
###### HBsAg seroconversion with peginterferon: HBeAg-positive pivotal trial
> “Sixteen patients receiving peginterferon alfa-2a (alone or in combination) had hepatitis B surface antigen (HBsAg) seroconversion, as compared with 0 in the group receiving lamivudine alone (P=0.001).”
> “In this study, HBsAg seroconversion was identified in 8 of 473 Asian patients (2 percent) and 8 of 47 white patients (17 percent) receiving peginterferon alfa-2a alone or in combination with lamivudine, as compared with none receiving lamivudine alone.”
Source: [Lau et al. (2005)](https://doi.org/10.1056/NEJMoa043470)
###### Durable HBsAg loss after finite peginterferon: 2022 AASLD-EASL endpoints conference
> “Historically, a finite course of pegIFNa monotherapy (48 weeks) can result in durable off-treatment HBsAg loss in up to approximately 11% of patients (mostly HBeAg positive) although these results vary by genotype and baseline serum ALT.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
###### Peginterferon added to or switched from nucleos(t)ide analogues: EASL 2025 evidence review
> “HBsAg loss rates can be improved by PEG-IFNα therapy. However, overall HBsAg loss rates were only 8% for the "add-on" therapy and 14% for the "switch" therapy.”
> “Tolerance and acceptance of add-on PEG-IFNα may be a concern as a recent multicentre, open-label, randomised-controlled trial in France found this regimen to be poorly tolerated, leading to early discontinuation of PEG-IFNα in 20% of patients but no significant increase in HBsAg clearance.”
> “Notably, a randomised-controlled trial demonstrated that in HBeAg-negative patients with HBV DNA <60 IU/ml for ≥2.5 years, switching from NAs to PEG-IFNα for 48 weeks significantly reduced virological relapse rates (7.8% vs. 20.9%) and increased HBsAg loss (21.5% vs. 9.0%) compared to NA cessation alone,”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Peginterferon add-on to nucleos(t)ide analogues: individual participant data meta-analysis
> “581 patients were included. At the start of peg-IFN therapy (SOT), 44% were hepatitis B envelope antigen (HBeAg) positive, mean HBsAg level was 3.03 log10 IU/mL (HBsAg<100: 12%; 100–1000: 28%; ≥1000: 60%), and planned duration of peg-IFN was 48 weeks in 496 patients (85%).”
> “At EOF, 50 (8.6%) patients achieved HBsAg loss (HBsAg<100/100–1000/≥1000: 37.7/9.8/2.3%, p<0.001) Findings were consistent across ethnicities (Caucasian: 30.0/8.7/3.6%; Asian: 39.3/9.2/2.2%).”
> “Peg-IFN add-on results in HBsAg loss in 18% of patients with SOT HBsAg<1000 IU/mL, and in 38% if SOT HBsAg<100 IU/mL.”
> “57 (10%) patients discontinued peg-IFN prior to the planned end-date, and these rates varied between 0% and 21% in the included studies (online supplemental table S1).”
Source: [Dongelmans et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13638273/)
###### Adverse effects and safety monitoring
> “Flu-like symptoms, fatigue, mood disturbances, cytopenia, autoimmune disorders in adults, anorexia and weight loss in children”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “A decline in leukocytes and platelets is common during PEG-IFNα-based therapy.”
> “ALT flares can also occur during treatment despite suppression of HBV DNA, particularly in the early treatment phase”
> “Psychiatric side effects, including depression, are significant concerns with PEG-IFNα treatment and should be carefully considered both during patient selection and throughout therapy to ensure proper management.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
> “Thirty-three patients had serious adverse events during treatment and up to eight weeks after therapy: 12 patients (4 percent) receiving peginterferon alfa-2a monotherapy, 16 patients (6 percent) receiving peginterferon alfa-2a plus lamivudine, and 5 patients (2 percent) receiving lamivudine monotherapy (Table 4).”
> “However, the rate of withdrawal from peginterferon alfa-2a therapy was less than 5 percent.”
Source: [Lau et al. (2005)](https://doi.org/10.1056/NEJMoa043470)
###### Concomitant use with bepirovirsen
> “Concomitant administration of HIBSAGO and peginterferon alfa-2a is not recommended.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### 2.2.2.1.3 Nucleos(t)ide Analogue Withdrawal
###### Recommendation against withdrawal before HBsAg loss: AASLD/IDSA 2025 guideline
> “In adults with chronic hepatitis B, who are HBeAg-negative without cirrhosis, with sustained undetectable HBV DNA on nucleos(t)ide analogue therapy, AASLD suggests not withdrawing nucleos(t)ide analogue therapy until HBsAg loss.”
> “Strength of recommendation: Conditional”
> “Certainty of evidence: Very Low”
> “An alternate and preferable approach for HBeAg negative persons on NA treatment is to continue treatment until HBsAg loss is achieved and confirmed, after which treatment can be stopped.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Criteria, monitoring, and restart rules for persons who wish to stop: AASLD/IDSA 2025 guideline
> “have a quantitative HBsAg level <100 IU/mL.”
> “Following withdrawal of treatment, serum ALT and HBV DNA should be monitored every 1-3 months for the initial 6 months, then every 3 months for the next 6 to 12 months. Thereafter, monitor at 3 to 6 month intervals depending on the ALT and HBV DNA values.”
> “an HBV DNA level ≥10,000 IU/mL (≥4 log IU/mL) regardless of ALT level, or”
> “ALT ≥5 x ULN regardless of HBV DNA or”
> “total bilirubin >2.5 mg/dL, or”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Evidence summary behind the AASLD/IDSA 2025 recommendation
> “The systematic review included 11 studies (4 RCTs and 7 observational studies) involving 1,957 individuals (948 in the discontinuation group and 1,009 in the continuation group).”
> “In the decision-making process, the committee considered that the majority of the evidence supporting the benefit of stopping therapy was derived from four small prospective RCTs in which the rates of HBsAg loss were modest, 10.6% over two years (versus 0% in those who remained on therapy, RR 12.65 (1.58 to 101.51) while the downsides, i.e. ALT flares 26.9% (RR 11.63 [0.15 to 891.61]) at two years and retreatment 23% (RR 0.24 [0.07-0.4]) at 1.5 years were substantial.”
> “Given the long-term safety of NA treatment and availability of low cost generics and reportedly higher rates of adverse complications including decompensation and death after NA discontinuation, from large cohort studies, the committee recommended against withdrawal of therapy until functional cure was achieved.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### HBsAg loss and relapse after discontinuation: technical review supporting the AASLD/IDSA 2025 guideline
> “PICO 3 analyses demonstrate that discontinuing antiviral therapy in persons who are HBeAg negative with undetectable HBV DNA increases HBsAg loss rates (OR: 12.65, 95% CI: 1.58–101.51) but carries moderate risks of virologic relapse (OR: 47.17, 95% CI: 2.79–797.35) and clinical flares.”
> “Discontinuation of therapy was associated with a higher risk of clinical flare, defined as ALT elevation>2× ULN if HBV DNA >2000 IU/mL.”
> “Clinical flare (5 y): Significantly higher with discontinuation (OR: 13.14, 95% CI: 1.09–158.85).”
> “The proportion requiring retreatment ranged from 13.9% to 100%, with a median interval between treatment discontinuation and restart of 12–42 weeks.”
> “Among the cohort studies, one cohort47 (62 individuals) with 3.5 years of follow-up reported a relapse rate of 22.6% (95% CI: 12.2%–33.0%), another cohort43 (325 individuals) with 5 years of follow-up reported a rate of 36.3% (95% CI: 31.1%–41.5%), and the last cohort44 (250 individuals) with 6 years of follow-up reported a rate of 56.4% (95% CI: 50.3%–62.5%).”
Source: [Pan et al. (2026)](https://doi.org/10.1097/HEP.0000000000001584)
###### Recommendations on stopping nucleos(t)ide analogues: EASL 2025 guideline
> “Antiviral therapy with NAs should only be discontinued after consultation with a physician experienced in the treatment of hepatitis B and if close monitoring is guaranteed. HBsAg levels, HBeAg status, comorbidities, duration of HBV DNA suppression, stage of liver fibrosis in addition to patient understanding and preference should be taken into account (LoE 2, strong recommendation, strong consensus).”
> “Antiviral therapy with NAs should be stopped after confirmed HBsAg loss with or without anti-HBs seroconversion in the absence of coexisting risk factors (LoE 2, strong recommendation, consensus).”
> “In selected HBeAg-negative patients without advanced liver disease, NA therapy can be discontinued before HBsAg loss if HBV DNA has been undetectable for at least 3-4 years, HBsAg level is low (for values see comments below), and close monitoring is guaranteed after the end of therapy (LoE 1-2, weak recommendation, consensus).”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### HBsAg loss, relapse, and severe events after stopping: EASL 2025 evidence review
> “In the prospective and randomised STOP-NUC study, the HBsAg loss rate 2 years after the end of therapy was 10% in all patients stopping NA treatment, and 28% in the subgroup of patients with an HBsAg level <1,000 IU/ml at the time of treatment discontinuation. No patient who continued NA therapy achieved HBsAg loss during this time.”
> “Of note, in multicentre studies in which Asians predominated and comprised up to 80% of the cohort, reported rates of functional cure were lower and generally did not exceed 10-15% at 5-6 years after discontinuation of NA therapy.”
> “A systematic review and meta-analysis assessed the risk of severe clinical events after discontinuing NA therapy, finding that 1.21% of patients experienced severe hepatitis flares or hepatic decompensation, with significantly higher risks in patients with cirrhosis (3.63%) and a 0.37% chance of flare-related death or liver transplantation.”
> “Frequent monitoring after NA discontinuation is essential, with assessments at least monthly for the first 6 months, followed by every 3 months for 12–24 months.”
> “Retreatment should be considered if HBV DNA exceeds 10,000 IU/ml, regardless of ALT levels, and initiated no later than when HBV DNA reaches ≥100,000 IU/ml to prevent severe liver injury.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Off-therapy outcomes in a multinational cohort: RETRACT-B
> “Among 1552 patients with CHB, cumulative probability of HBsAg loss was 3.2% at 12 months and 13.0% at 48 months of follow-up.”
> “Virologic relapse occurred in 1207 patients, and cumulative probabilities increased from 47.8% (95% CI, 45.3%–50.3%) at 6 months to 68.9% (95% CI, 66.5%–71.2%) at 12 months and reached 83.4% (95% CI, 81.2%–85.5%) at 48 months of follow-up (Figure 2B).”
> “After NA cessation, 729 patients were retreated, and the cumulative probability of retreatment increased from 16.2% (95% CI, 14.4%-18.2%) at 6 months to 29.8% (95% CI, 27.5%–32.2%) at 12 months of follow-up and reached 54.7% (95% CI, 51.7%-57.7%) at 48 months (Figure 2F).”
> “There were 19 patients who developed hepatic decompensation after NA cessation (8/184 [4.3%] patients with cirrhosis vs 11/1368 [0.8%] patients without cirrhosis; P < .001) with an incidence rate of 0.48 per 1000 person-months.”
> “Death occurred in 7 (36.8%) of the 19 decompensated patients, of whom 6 died after starting retreatment.”
Source: [Hirode et al. (2022)](https://doi.org/10.1053/j.gastro.2021.11.002)
###### Discontinuation considered only exceptionally: WHO 2024 guideline
> “Antiviral therapy is lifelong. Discontinuation of nucleos(t)ide analogue therapy may be considered exceptionally for:”
> “Relapse is common after stopping therapy with nucleos(t)ide analogues.”
Source: [WHO hepatitis B guidelines (2024)](https://iris.who.int/server/api/core/bitstreams/34470cc8-af90-4d7b-a949-ef27e5d0726f/content)
###### Stopping after HBsAg loss: AASLD 2018 guidance
> “Treatment discontinuation in persons with cirrhosis is not recommended owing to the potential for decompensation and death, although data are limited.”
> “Treatment discontinuation may be considered in persons who have demonstrated loss of HBsAg. However, there is currently insufficient evidence to definitively guide treatment decisions for such persons.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Nucleos(t)ide analogue cessation after bepirovirsen: label criteria
> “HIBSAGO must be stopped upon completion of 24 weeks of treatment, and patients must remain on their NrtI therapy for at least an additional 24 weeks. Following the 24 weeks of further NrtI treatment, stopping NrtI therapy can be considered in those patients who:”
> “are hepatitis B e-antigen (HBeAg) negative,”
> “have HBV DNA “If NrtI therapy is stopped, frequent monitoring of HBsAg, HBV DNA, and hepatic function is recommended for at least one year following NrtI therapy cessation, with routine monitoring as clinically indicated afterwards”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### 2.2.2.1.4 Limitations of Current Therapies
###### Summary: limitations of current therapies
Guideline-preferred nucleos(t)ide analogues suppress HBV DNA but are given long term: the AASLD 2018 guidance suggests “indefinite antiviral therapy for adults with HBeAg-negative, immune-active CHB”, and the WHO 2024 guideline states that “Antiviral therapy is lifelong.” A meta-analysis of 34 studies reported a pooled annual HBsAg seroclearance rate of 1.02%, and 8-year tenofovir alafenamide data show HBsAg loss in 2% to 3% of participants. In the PAGE-B cohort of 1,644 Caucasian patients treated with entecavir or tenofovir, the 10- and 15-year cumulative incidences of HCC were 10.9% and 13.2%. In a cohort of 6696 patients receiving long-term nucleos(t)ide analogue therapy, the discontinuation probability was 29.4% at 12 months and 55.6% at 5 years. Peginterferon is a finite alternative with higher HBsAg loss than nucleos(t)ide analogues, but the AASLD/IDSA guideline states that it “is rarely used, given its limitations of applicability, safety and tolerability”.
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/); [WHO hepatitis B guidelines (2024)](https://iris.who.int/server/api/core/bitstreams/34470cc8-af90-4d7b-a949-ef27e5d0726f/content); [Yeo et al. (2019)](https://pubmed.ncbi.nlm.nih.gov/30342034/); [Buti et al. (2024)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11599788/); [Papatheodoridis et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42409322/); [Anderson et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12265875/); [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018); [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Indefinite duration of nucleos(t)ide analogue therapy
> “The AASLD suggests indefinite antiviral therapy for adults with HBeAg-negative, immune-active CHB unless there is a compelling rationale for treatment discontinuation”
> “A decision to discontinue therapy for HBeAg-negative adults without cirrhosis requires careful consideration of risks and benefits for health outcomes, including the following: (i) risk for virological relapse, hepatic decompensation, liver cancer, and death; (ii) burden of continued antiviral therapy, financial concerns associated with medication costs and long-term monitoring, adherence, and potential for drug resistance with treatment interruptions; and (iii) patient and provider preferences.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “Available treatments for hepatitis B e antigen (HBeAg)-negative chronic hepatitis B are associated with poor sustained responses. As a result, nucleoside and nucleotide analogues are typically continued indefinitely, a strategy associated with the risk of resistance and unknown long-term safety implications.”
Source: [Marcellin et al. (2004)](https://pubmed.ncbi.nlm.nih.gov/15371578/)
###### Current therapies are not curative
> “Current therapies (pegylated interferon alfa [pegIFNa] and nucleos(t)ide analogues [NAs]) are not curative due to persistence of covalently closed circular DNA (cccDNA), a stable, non-integrated form of viral DNA located in the hepatocyte nucleus, as well as HBV DNA that is directly integrated into the host genome.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
> “Although treatment is not considered curative, antiviral treatment, monitoring, and liver cancer surveillance can reduce morbidity and mortality.”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
###### Low HBsAg loss on nucleos(t)ide analogues: pivotal and long-term trial data
| Regimen and duration | HBeAg-positive | HBeAg-negative |
| --- | --- | --- |
| Entecavir, 48 weeks | “HBsAg loss: 2%” | “HBsAg loss: <1%” |
| Tenofovir disoproxil fumarate, 96 weeks | “HBsAg loss: 1%” | “HBsAg loss:0%” |
| Tenofovir alafenamide, 96 weeks | “HBsAg loss: 1%” | “HBsAg loss:<1%” |
| Tenofovir alafenamide, 5 years | “HBsAg loss: 0.8%” | “HBsAg loss:1.2%” |
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
> “Low rates of HBsAg loss on NA treatment are ascribed to the limited effect of NAs on the cccDNA template and to the significant contribution of HBV integration to HBsAg production, especially in HBeAg-negative individuals.”
> “Achieving functional cure (HBsAg loss) remains rare with current therapies. The prospect of effective finite treatments is highly appealing, particularly given the challenges associated with the strict adherence required for prolonged NA therapy, especially for young patients. Thus, there is an unmet need for curative therapies.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
> “Annual rates of spontaneous and on-treatment NA-related HBsAg loss remain very low (~0.5-1%).”
> “Increasingly, there is emphasis on the achievement of HBsAg loss as the desired endpoint for treatment (functional cure), because of its association with reduction in clinical outcomes and long-term durability, though it is recognized that functional cure is infrequent with current approved therapies, albeit higher with peginterferon than for NAs.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Residual hepatocellular carcinoma risk during long-term nucleos(t)ide analogue therapy
> “Of 1,644 patients, 903 were followed beyond year 10 (mean:14 ± 2 years). The 10- and 15-year cumulative incidences of HCC were 10.9% and 13.2%, respectively. The HCC IR was 1.25 before year 10 and 0.55/100 PYs after year 10 (p <0.001), with similar findings after inverse probability weighting.”
> “Despite >10 years of NA therapy, patients with CHB remain at risk of HCC, although the incidence rate declines significantly. HCC remains the main determinant of mortality.”
Source: [Papatheodoridis et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42409322/)
> “Nevertheless, a risk of adverse liver-related outcomes remains despite HBV DNA suppression, and this risk can be mitigated by achieving HBsAg loss.”
Source: [Dongelmans et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13638273/)
###### Persistence and adherence with long-term nucleos(t)ide analogue therapy: U.S. claims data
> “In total, 6696 patients met the study eligibility criteria.”
> “Overall, 40.6% of patients discontinued treatment; discontinuation probability was 29.4% at 12 months and 55.6% at 5 years. Of those who discontinued, 45.7% restarted during the study period. Mean adherence (proportion of days covered [PDC]) was 0.91, and 86.5% of participants had a PDC ≥ 80%.”
Source: [Anderson et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12265875/)
> “An inception cohort of 564 patients (24%), without a NA prescription in the 6 months pre-index period and at least 2 years of follow-up, was created. Persistence among the inception cohort was 29% for first year and 14% for first 2 years.”
Source: [Sbarigia et al. (2020)](https://pmc.ncbi.nlm.nih.gov/articles/PMC7089729/)
###### Peginterferon tolerability and response variability
> “The variable response rates and unfavourable safety profile of PEG-IFNα treatment are major drawbacks that limit patients' eligibility or prompt patients to decline this treatment option.”
> “Despite the slightly higher HBeAg/anti-HBe seroconversion rates, the overall rate of HBsAg loss after PEG-IFNα therapy is still low.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Relapse risk with finite nucleos(t)ide analogue therapy
> “Discontinuation increases HBsAg loss but carries a substantial risk of virological relapse and clinical flares.”
Source: [Pan et al. (2026)](https://doi.org/10.1097/HEP.0000000000001584)
##### 2.2.2.2 Place in Treatment, Anticipated Use, and Care Setting
###### Summary: anticipated place in therapy
The label indicates bepirovirsen “in combination with nucleos(t)ide analog reverse transcriptase inhibitor (NrtI) therapy” for adults without cirrhosis who have received NrtI therapy for at least 6 months, have suppressed HBV DNA, and have HBsAg levels of 3,000 IU/mL or less by an FDA-authorized test, with a maximum treatment duration of 24 weeks. Its anticipated position is therefore among virologically suppressed adults already receiving entecavir, tenofovir disoproxil fumarate, or tenofovir alafenamide, the three nucleos(t)ide analogues the AASLD/IDSA guideline lists as preferred. The AASLD/IDSA and EASL 2025 guidelines both identify HBsAg loss (functional cure) as the desired treatment endpoint, and the AASLD/IDSA guideline states that updated guidelines can be anticipated “as new therapies are FDA-approved”. The label requires the initial dose to be given under healthcare provider supervision, permits patient or caregiver self-administration thereafter, and requires laboratory monitoring before, during, and after treatment; analysts quoted by Fierce Pharma stated that the monitoring burden “could slow adoption outside specialist hepatology centers.” In the pivotal trials, the functional cure rate was 19% (233 of 1,220) overall and 26% (200 of 768) in participants with baseline HBsAg of 1,000 IU/mL or less, a group GSK states represents “approximately 45% of diagnosed CHB cases globally”.
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF); [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549); [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018); [Fierce Pharma (2026)](https://www.fiercepharma.com/pharma/gsk-brings-promise-functional-cure-hepatitis-b-finish-line-fda-nod-hibsago); [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Labeled population
> “HIBSAGO is indicated in combination with nucleos(t)ide analog reverse transcriptase inhibitor (NrtI) therapy for treatment of chronic hepatitis B virus (HBV) infection in adult patients without cirrhosis:”
> “who have been on NrtI therapy for at least 6 months and have suppressed HBV deoxyribonucleic acid (DNA), and”
> “who have HBV surface antigen (HBsAg) levels less than or equal to 3,000 IU/mL as determined by an FDA-authorized test”
> “Prior to initiation of HIBSAGO for treatment of chronic HBV infection, test all patients to quantify HBsAg levels in serum or plasma to identify patients with baseline HBsAg levels less than or equal to 3,000 IU/mL”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Regulator description of the approved population and companion diagnostic
> “Hibsago is approved for certain adults without cirrhosis who have been taking HBV antiviral therapy for at least six months, have suppressed levels of HBV in their blood and have hepatitis B surface antigen (HBsAg) levels of 3,000 IU/mL or less, as determined by an FDA-authorized test.”
> “The FDA also authorized the Roche Elecsys HBsAg II quant II RxDx assay as a companion diagnostic device to aid in the selection of patients with chronic HBV infection for treatment with antiviral therapy in accordance with the FDA approved drug labeling and to assist in monitoring patients throughout the course of treatment.”
> “Patients take it alongside their existing hepatitis B medicine and continue that medicine for at least 24 weeks after their last Hibsago injection. Some patients may then be able to stop their existing medicine if they meet certain health and lab test requirements.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
###### Care setting and administration requirements in the label
> “HIBSAGO therapy should be prescribed only when appropriate laboratory monitoring can be performed to manage the treatment regimen.”
> “HIBSAGO must be administered under the guidance and supervision of a healthcare provider for the initial dose to ensure proper injection technique.”
> “Patients or caregivers may administer HIBSAGO after their healthcare provider determines that it is appropriate and with medical follow-up, including laboratory testing.”
> “The maximum recommended duration of HIBSAGO treatment is 24 weeks”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Manufacturer statements on intended population, testing, and administration
> “Quantitative surface antigen testing will support the diagnosis and identification of patients suitable for treatment with bepirovirsen who have baseline HBsAg levels ≤3000 IU/ml. Several tests are available, including a recently authorised FDA test.”
> “For the first time, with Hibsago, US patients have the potential to achieve functional cure after a six-month treatment course, with the added convenience of the option of self-administration after the first dose.”
> “Pooled data from the B-Well phase III trials showed that six-month treatment with bepirovirsen achieved a clinically meaningful 19% functional cure response rate (233 of 1,220 vs. 0 of 614 in the placebo group).”
> “In a key secondary endpoint, a functional cure rate of 26% (200 of 768 vs. 0 of 393 in the placebo group) was achieved in participants with ≤1000 IU/ml HBsAg level, a group that represents approximately 45% of diagnosed CHB cases globally.”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
###### Launch timing and anticipated uptake by care setting
> “Hibsago should be made available to U.S. patients before the end of the year, a GSK spokesperson told Fierce, adding that the drug’s list price will become public once pricing and reimbursement discussions have wrapped with payers.”
> “The analysts also spotlighted Hibsago's black box warning for both hepatic flares and thrombocytopenia, noting that the subsequent every-other-week or weekly monitoring burden patients will face could in turn "work against the commercial uptake and could slow adoption outside specialist hepatology centers."”
Source: [Fierce Pharma (2026)](https://www.fiercepharma.com/pharma/gsk-brings-promise-functional-cure-hepatitis-b-finish-line-fda-nod-hibsago)
###### Functional cure as a treatment goal: AASLD/IDSA 2025 guideline
> “Increasingly, there is emphasis on the achievement of HBsAg loss as the desired endpoint for treatment (functional cure), because of its association with reduction in clinical outcomes and long-term durability”
> “As the field of HBV therapeutics is robust and new drug therapies focused on functional cure are anticipated, updated guidelines can be anticipated as new therapies are FDA-approved.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Functional cure as a treatment goal: EASL 2025 guideline
> “Loss of HBsAg (post therapy) is the ultimate goal of treatment, is the defining feature of functional cure of HBV infection”
> “Several novel compounds with distinct mechanisms of action are currently in advanced clinical development.”
> “These differences may also hold significant relevance as NAs form the backbone of novel therapeutic strategies aimed at achieving HBV functional cure.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Target population and role of nucleos(t)ide analogues in finite-therapy trials: 2022 AASLD-EASL endpoints conference
> “Clinical trials should initially focus on patients with HBeAg-positive or negative chronic hepatitis B, who are treatment-naïve or virally suppressed on nucleos(t)ide analogues.”
> “As the only approved class of oral antiviral for CHB and the standard-of-care therapy for a majority of patients, NAs will have an important role to play in combination with novel agents in development because of their potency in inhibiting the production of new HBV DNA containing virions, and their well-characterized long-term safety profiles.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
##### 2.2.2.3 Heterogeneity of Treatment Effect
###### Bepirovirsen: response by baseline HBsAg level in the pivotal trials
| Baseline HBsAg subgroup | B-Well 1, HIBSAGO n/N (%) | B-Well 1, placebo n/N (%) | B-Well 2, HIBSAGO n/N (%) | B-Well 2, placebo n/N (%) |
| --- | --- | --- | --- | --- |
| ≤3,000 IU/mL (primary endpoint) | “127/650 (20)” | “0/328 (0)” | “106/570 (19)” | “0/286 (0)” |
| ≤1,000 IU/mL (key secondary endpoint) | “105/426 (25)” | “0/214 (0)” | “95/342 (28)” | “0/179 (0)” |
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Bepirovirsen: subgroups with lower response, genotype, and early on-treatment predictor
> “The primary endpoint response rate was lower in participants with any of the following characteristics: higher HBsAg values at baseline, HBeAg positive at baseline, and age 65 years or older (see Figure 1).”
> “Overall response rates were 28% for genotype A, 21% for genotype B, 20% for genotype D, and 15% for genotype C. Response rates declined with increasing baseline HBsAg levels and fell below 10% for genotypes B and C at baseline HBsAg levels exceeding 1,000 IU/mL.”
> “Among participants with baseline HBsAg ≤3,000 IU/mL who met this criterion, 34% (203/601) had sustained suppression of HBV DNA and HBsAg not detected at 24 weeks after cessation of all chronic HBV treatment. Participants who did not meet this criterion (who had HBsAg ≥1 IU/mL at Week 12) had a 2% (9/498) probability of having sustained suppression of HBV DNA and HBsAg not detected at 24 weeks after cessation of all chronic HBV treatment.”
> “Among participants with baseline HBsAg ≤1,000 IU/mL who met this criterion, 42% (179/426) achieved this endpoint, and those who did not meet this criterion had a 2.5% (7/280) probability of achieving this endpoint.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Bepirovirsen: on-treatment ALT flares accompanying HBsAg decline
> “HIBSAGO may cause on-treatment hepatic flares with increases in ALT of >20-40x ULN associated with decline in HBsAg.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Bepirovirsen: baseline HBsAg threshold derived from the phase 2b trial
> “In group 1, a total of 16% of the participants receiving NA therapy and 25% of those not receiving NA therapy with a low HBsAg level (≤3 log10 IU per milliliter) at baseline had a primary-outcome event, as compared with 6% and 7% of participants, respectively, with a high HBsAg level (>3 log10 IU per milliliter) at baseline (Fig. S3). A receiver-operating-characteristic analysis in group 1 indicated that an HBsAg level of approximately 3000 IU per milliliter (3.5 log10 IU per milliliter) at baseline may be an appropriate cutoff point for predicting response (Fig. S4).”
Source: [Yuen et al. (2022)](https://www.nejm.org/doi/full/10.1056/NEJMoa2210027)
###### Nucleos(t)ide analogues and natural history: HBeAg status and baseline levels
> “A higher proportion of patients who tested negative for HBeAg at baseline had seroclearance (1.33%; 95% CI, 0.76-2.05) than those who tested positive for HBeAg (0.40%; 95% CI, 0.25-0.59) (P < .01).”
> “Having HBsAg seroclearance was also associated with a lower baseline HBV DNA level (6.61 log10 IU/mL; 95% CI, 5.94-7.27) vs not having HBsAg seroclearance (7.71 log10 IU/mL; 95% CI, 7.41-8.02) (P < .01) and with a lower level of HBsAg at baseline (2.74 log10 IU/mL; 95% CI, 1.88-3.60) vs not having HBsAg seroclearance (3.90 log10 IU/mL, 95% CI, 3.73-4.06) (P < .01).”
Source: [Yeo et al. (2019)](https://pubmed.ncbi.nlm.nih.gov/30342034/)
> “HBsAg loss was independently associated with older age and baseline HBeAg positivity.”
Source: [Papatheodoridis et al. (2026)](https://pubmed.ncbi.nlm.nih.gov/42409322/)
###### Peginterferon: genotype and baseline predictors in guidelines
> “HBV genotype: A and B genotypes are more likely to achieve HBeAg and HBsAg loss with peg-IFN than non-A or non-B genotypes.”
> “HBV genotyping can be useful in patients being considered for peg-IFN therapy, as genotypes A and B are associated with higher rates of HBeAg and/or HBsAg loss than genotype C and D, but it is not otherwise recommended for routine testing or follow-up of patients with CHB.”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
> “Baseline predictors of PEG-IFNα response in HBeAg-positive patients include a low viral load, elevated serum ALT (2-5× ULN), high histological inflammatory activity, younger age, female sex, and HBV genotypes A and B, which are associated with higher rates of HBeAg/anti-HBe seroconversion and HBsAg loss compared to genotypes D and C, respectively.”
> “Patients with low HBsAg levels (e.g. <1,500 IU/ml), HBeAg-negative status, and HBV DNA negativity may benefit from this therapy, regardless of prior IFNα treatment. Predictive factors for a positive treatment response include younger age (≤40 years) and low baseline or week 12 HBsAg levels.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Peginterferon add-on: baseline HBsAg as the main predictor
> “In a multivariable logistic regression model, adjusting for HBeAg status and viral load at start of therapy, lower SOT HBsAg was the main predictor for HBsAg loss (adjusted odds ratio (aOR) 0.28; 95% CI 0.20 to 0.39, p<0.001; table 2). HBeAg status was not associated with HBsAg loss after adjusting for SOT HBsAg (aOR 1.19; 95% CI 0.51 to 2.76, p=0.68). In univariable analyses, ethnicity, age or ALT at baseline were not associated with HBsAg loss (p>0.05).”
Source: [Dongelmans et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13638273/)
###### Nucleos(t)ide analogue withdrawal: end-of-treatment HBsAg level and ethnicity
> “HBsAg loss was higher among Whites (vs Asians: subdistribution hazard ratio, 6.8; 95% confidence interval, 2.7–16.8; P < .001) and among patients with HBsAg levels <100 IU/mL at end of therapy (vs ≥100 IU/mL: subdistribution hazard ratio, 22.5; 95% confidence interval, 13.1–38.7; P < .001).”
> “At 48 months of follow-up, the cumulative probability of HBsAg loss was higher among patients aged ≥50 years at end of therapy (16.8%; 95% CI, 12.9%–21.7%) compared with those aged <50 years (8.7%; 95% CI, 6.0%–12.5%) (Figure 3A), among Whites (36.5%; 95% CI, 26.0%–49.5%) compared with Asians (10.6%; 95% CI, 8.1%–13.7%) (Figure 3C), among patients treated with TDF before cessation (18.1%; 95% CI, 12.2%–26.5%) compared with ETV-treated patients (10.5%; 95% CI, 7.8%–14.2%) (Figure 3D), and among patients with HBsAg <100 IU/mL at end of therapy (43.0%; 95% CI, 34.4–52.7%) compared with patients with HBsAg levels between 100–1000 IU/mL at end of therapy (7.4%; 95% CI, 4.6–11.7%) or HBsAg >1000 IU/mL at end of therapy (1.1%; 95% CI, 0.3–3.5%; Figure 3F).”
Source: [Hirode et al. (2022)](https://doi.org/10.1053/j.gastro.2021.11.002)
> “It is noteworthy that the predictive thresholds for HBsAg levels are different for Asians and Caucasians: for Asians, an HBsAg value <100 IU/ml is associated with a favourable outcome, whereas for Caucasians, the threshold is <1,000 IU/ml.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Peginterferon: HBsAg seroconversion by ethnicity in the HBeAg-positive pivotal trial
> “At week 72, HBsAg seroconversion was identified in eight patients receiving peginterferon alfa-2a monotherapy (three Asian and five white patients, five with HBV genotype A and three with genotype C) and in eight receiving peginterferon alfa-2a plus lamivudine (five Asian and three white patients; two with genotype A, one with genotype B, four with genotype C, and one with genotype H).”
Source: [Lau et al. (2005)](https://doi.org/10.1056/NEJMoa043470)
##### 2.2.2.4 Care Management Intervention Strategies
###### Linkage to care and treatment in the United States
> “In a 2008–2016 study of adults with chronic HBV infection and commercial insurance, 36% (6,004 of 16,644) of patients were linked to care (defined as having had an ALT test and HBV DNA or HBeAg test) (51). Of the patients with chronic HBV infection with prescription claims, 18% (2,926 of 16,572) were treated.”
> “Persons who receive a diagnosis of chronic HBV infection can benefit from monitoring and counseling, including mental health support (111).”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
> “About half of the cohort (n = 6,559, 52.3%) did not have a complete laboratory evaluation (defined as having HBeAg, HBV DNA, and ALT tests) and only 72.4% (n = 9,129) had an "adequate" evaluation (at least HBV DNA and ALT) during the entire study period. Of those with an adequate evaluation, 11.2% were treatment eligible by AASLD criteria and 13.9% by EASL criteria; 60.4% of AASLD eligible patients and 54.3% of EASL eligible patients received treatment within 12 months from becoming eligible.”
> “Patients who visited a specialist had a higher chance of receiving adequate evaluation and treatment.”
Source: [Ye et al. (2022)](https://pubmed.ncbi.nlm.nih.gov/34474097/)
###### Global cascade of care
> “Of these individuals, 36·0 million were diagnosed, and only 6·8 million of the estimated 83·3 million eligible for treatment were on treatment.”
Source: [Polaris Observatory Collaborators (2023)](https://pubmed.ncbi.nlm.nih.gov/37517414/)
###### Disparities in evaluation and treatment initiation
> “Overall, 73.3% (9,206 patients) received adequate evaluation. Among the adequately evaluated, 32.6% (3,001 patients) were treatment eligible by AASLD criteria, 83.3% (2,500 patients) of whom were initiated on NAs, with consistent findings in analyses using EASL criteria.”
> “Improved linkage to care with linguistically competent and culturally sensitive approaches is needed.”
Source: [Kudaravalli et al. (2024)](https://doi.org/10.1016/j.jhep.2024.02.033)
###### Specialist care and referral
> “People with chronic hepatitis B should be under the care of a clinician with expertise in managing hepatitis B.”
Source: [CDC Clinical Care of Hepatitis B (2025)](https://www.cdc.gov/hepatitis-b/hcp/clinical-care/index.html)
###### Hepatocellular carcinoma surveillance recommendations: AASLD/IDSA 2025 guideline
> “In persons who achieved HBsAg loss, AASLD suggests continued HCC surveillance for those with cirrhosis, with family history of HCC, men who experienced HBsAg loss after age 40, and women who experienced HBsAg loss after age 50 years.”
> “HCC surveillance with ultrasound and serum AFP performed at semiannual (approximately every 6 mo) intervals is recommended as the most cost-effective approach per the 2023 AASLD HCC guideline.”
> “CHB infection is the most common cause of HCC worldwide.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Hepatocellular carcinoma surveillance recommendations: EASL 2025 guideline
> “HCC surveillance should involve abdominal ultrasound performed every 6 months by an experienced operator in all at-risk populations (LoE 2, strong recommendation, strong consensus).”
> “HCC surveillance should be continued in at-risk patients irrespective of effective antiviral therapy or HBsAg loss (LoE 2, strong recommendation, strong consensus).”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Use of hepatocellular carcinoma surveillance in practice: U.S. claims data
> “Of 6831 patients (1122 on antiviral treatment, 5709 untreated), only 39.3% and 51.3% had received any abdominal imaging after 6 and 12 months, respectively, and patients were up to date with HCC surveillance guidelines for only 28% of the follow‐up time.”
Source: [Nguyen et al. (2022)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9701467/)
###### Monitoring during nucleos(t)ide analogue therapy
> “HBsAg status should be tested every 12 months. Ideally, a quantitative determination of HBsAg should be performed (LoE 3, strong recommendation, strong consensus).”
> “In the event of a partial virological response or virological non-response (Box 1), the patient's adherence to treatment should be assessed in the first instance (LoE 1, strong recommendation, strong consensus).”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Monitoring after nucleos(t)ide analogue cessation following bepirovirsen
> “Severe acute exacerbations of HBV infection may occur after discontinuation of anti-HBV therapy. If NrtI therapy is discontinued after completing HIBSAGO treatment, frequent monitoring is recommended. Patients should be closely monitored with both laboratory (HBsAg, HBV DNA, and hepatic function) and clinical follow-up for at least one year following NrtI therapy cessation, with routine monitoring as clinically indicated afterwards, to detect acute exacerbations of HBV infection and the possible need for resumption of HBV treatment.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
> “In studies of treatment withdrawal, HBV DNA and ALT levels should be frequently monitored during the first 6-12 months.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
###### Screening and vaccination of contacts
> “All patients who test positive for active HBV infection should be provided information on how to prevent transmission to others (Box 5). Notification, testing, and vaccination of their household contacts or former household contacts, sex partners, and needle-sharing contacts are recommended, as appropriate.”
> “In a study of programs testing and linking patients with hepatitis B to care in the United States, 14% of household contacts of persons who were HBsAg positive were themselves HBsAg positive, and 30% had a history of infection (anti-HBc positive) (55).”
Source: [Conners et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC9997714/)
> “HBV vaccination is the primary intervention to prevent HBV transmission to susceptible individuals in all settings, including those with a known higher risk of exposure.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “Taking HIBSAGO does not stop you from passing HBV to others.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
##### 2.2.2.5 Other Product Development or Post-marketing Obligations Required by the FDA
###### Postmarketing requirements and commitments in an FDA approval letter
No evidence found.
###### Populations without established safety and efficacy at approval
> “The safety and effectiveness of HIBSAGO have not been established in patients less than 18 years of age.”
> “Insufficient data are available on the safety of HIBSAGO in patients with moderate or severe renal impairment or end stage renal disease (eGFR less than or equal to 59 mL/min/1.73m2).”
> “The safety and efficacy of HIBSAGO in patients with cirrhosis have not been established.”
> “The safety and efficacy of HIBSAGO have not been established in patients with hepatitis C virus (HCV) coinfection.”
> “There are insufficient data on the use of HIBSAGO in pregnant women to evaluate for a drug-associated risk of major birth defects, miscarriage or other adverse maternal or fetal outcomes.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Ongoing trial in HIV and HBV coinfection
> “This study will evaluate the efficacy and safety of bepirovirsen compared to placebo in participants with human immunodeficiency virus (HIV)/hepatitis B virus (HBV) co-infection.”
Source: [ClinicalTrials.gov NCT06497504](https://clinicaltrials.gov/study/NCT06497504)
###### Ongoing pharmacokinetic study in moderate and severe renal impairment
> “The purpose of the study is to understand if blood levels of bepirovirsen are different in adults with kidney disease compared to healthy adults who do not have kidney disease.”
Source: [ClinicalTrials.gov NCT07168356](https://clinicaltrials.gov/study/NCT07168356)
###### European Union paediatric investigation plan: agreed measures
| Area | Measure |
| --- | --- |
| Clinical studies, Study 1 (206839) | “Open label, randomised, controlled study of pharmacokinetics (PK), safety and efficacy of bepirovirsen in children from 2 years to less than 18 years of age with chronic hepatitis B virus (HBV) infection.” |
| Extrapolation, modelling and simulation studies, Study 2 | “Population PK modelling and Exposure-Response study to determine paediatric doses of bepirovirsen for children from 2 years to less than 18 years of age.” |
| Extrapolation, modelling and simulation studies, Study 3 | “PK bridging/extrapolation of efficacy data to support the use of bepirovirsen for the treatment of chronic hepatitis B in children from 2 years to less than 18 years of age.” |
Source: [EMA paediatric investigation plan decision P/0254/2022 (2022)](https://www.ema.europa.eu/en/documents/pip-decision/p-254-2022-ema-decision-8-july-2022-agreement-paediatric-investigation-plan-granting-deferral-granting-waiver-bepirovirsen-emea-003082-pip01-21_en.pdf)
###### European Union paediatric investigation plan: waiver, completion date, and deferral
> “the paediatric population from birth to less than 2 years of age;”
> “Date of completion of the paediatric investigation plan:”
> “By May 2034”
Source: [EMA paediatric investigation plan decision P/0254/2022 (2022)](https://www.ema.europa.eu/en/documents/pip-decision/p-254-2022-ema-decision-8-july-2022-agreement-paediatric-investigation-plan-granting-deferral-granting-waiver-bepirovirsen-emea-003082-pip01-21_en.pdf)
###### Further development: sequential daplusiran/tomligisiran followed by bepirovirsen
> “The study is intended to evaluate the efficacy and safety of 2 different doses of DAP/TOM followed by bepirovirsen in participants living with CHB on standard of care nucleos(t)ide analogue (NA) therapy.”
Source: [ClinicalTrials.gov NCT06537414](https://clinicaltrials.gov/study/NCT06537414)
##### 2.2.2.6 Ongoing Post-approval Monitoring
###### Adverse reaction reporting
> “To report SUSPECTED ADVERSE REACTIONS, contact GlaxoSmithKline at 1-888-825-5249 or FDA at 1-800-FDA-1088 or www.fda.gov/medwatch.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Laboratory monitoring after bepirovirsen discontinuation
> “Laboratory tests must be measured prior to, during, and following discontinuation of treatment.”
> “In all patients with abnormal values at the time of HIBSAGO discontinuation, obtain ALT and total bilirubin values at 4, 12, and 24 weeks post-treatment to assess recovery of ALT values to within the normal range, as appropriate”
> “In all patients with abnormal values at the time of HIBSAGO discontinuation, obtain repeat platelet counts 4 and 12 weeks post-treatment to assess for platelet count recovery, as appropriate.”
> “In all patients with abnormal values at the time of HIBSAGO discontinuation, obtain repeat eGFR 4 and 12 weeks post-treatment to assess for renal function recovery, as appropriate.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Monitoring after nucleos(t)ide analog discontinuation
> “Patients should be closely monitored with both laboratory (HBsAg, HBV DNA, and hepatic function) and clinical follow-up for at least one year following NrtI therapy cessation, with routine monitoring as clinically indicated afterwards, to detect acute exacerbations of HBV infection and the possible need for resumption of HBV treatment.”
> “If NrtI therapy is discontinued after completing HIBSAGO treatment, advise patients of the importance of frequent monitoring to assess the possible need for resumption of HBV treatment”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Monitoring statements in the Medication Guide
> “Your healthcare provider will do blood tests to check your liver and platelet count, before you start HIBSAGO, during treatment, and if you have abnormal blood tests for up to 24 weeks after you stop HIBSAGO.”
> “After you finish your treatment with HIBSAGO, do not stop taking your NrtI treatment unless your healthcare provider tells you to. If you stop taking NrtI treatment, your HBV may return. It is important that you make sure you still get blood tests done.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Companion diagnostic for monitoring during treatment
> “to assist in monitoring patients throughout the course of treatment”
> “Patients need regular blood tests and follow up with their healthcare provider before and during treatment to monitor these risks.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
###### Durability of response off all treatment through week 96 in B-Well 1 and B-Well 2
> “HIBSAGO recipients who met the criteria to discontinue NrtI therapy and discontinued NrtI therapy at Week 48 (295/1,220 across both trials) were monitored for an additional 48 weeks with assessments at Week 72 to assess the primary endpoint and Week 96 to evaluate the long-term durability of response”
> “At Week 72, 24 weeks after stopping NrtI therapy, 79% (233/295) of these participants met the primary endpoint. Of the 233 participants who met the primary endpoint at Week 72, 91% (211/233) maintained response off all HBV treatment at Week 96.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Long-term follow-up study of durability: B-Sure
> “This is a global multi-center, long-term follow-up study to assess durability of efficacy, as measured by maintenance of treatment response from the parent study, in participants who participated in a previous bepirovirsen study and achieved a complete or partial response.”
> “Participants rolling over from studies 202009 and 219288 who have stopped NA treatment during the parent study will be included in this arm. Participants will be followed up for 33 months. No study treatment will be administered in this study.”
Source: [ClinicalTrials.gov NCT04954859](https://clinicaltrials.gov/study/NCT04954859)
###### Risk evaluation and mitigation strategy
No evidence found.
###### Pregnancy exposure registry
No evidence found.
##### 2.2.2.7 Expected Outcomes of Therapy
###### Treatment endpoints: functional and partial cure definitions
> “The recommended endpoint of novel therapy is functional cure defined as HBsAg loss using a conventional assay for detection of HBsAg (limit of detection 0.05 IU/mL) and HBV DNA below the lower limit of quantification (i.e. < 10 IU/ml) at 24 weeks off-therapy.”
> “An intermediate endpoint on the pathway to functional cure is partial cure, defined as HBsAg <100 IU/ml and HBV DNA below the lower limit of quantification (i.e. < 10 IU/ml) at 24 weeks off- treatment. However, further clinical data are needed to establish that HBsAg decline to <100 IU/ml is a clinically meaningful threshold suitable for use as part of composite clinical trial endpoint.”
> “The panel continues supporting the recommendation that anti-HBs is not required for definition of functional cure, as HBsAg loss is maintained in over 90% of patients with or without anti-HBs in long-term follow-up with currently approved therapies but will need to be confirmed with therapies in development.”
Source: [Ghany et al. (2023)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12373085/)
###### Expected characteristics of functional and partial cure: 2022 definitions
| Characteristic | Functional cure (2022 definition) | Partial cure (2022 definition) |
| --- | --- | --- |
| HBsAg levels, IU/ml | “
###### Treatment goals beyond liver outcomes: AASLD/IDSA 2025 guideline
> “Other goals of antiviral therapy include reduction in onward transmission (both vertical (mother-to-child) and horizontal (e.g., sexual, parenteral, nosocomial)), improvement in patient reported outcomes and quality of life as well as decreased stigma.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
###### Clinical outcomes after HBsAg loss: EASL 2025 evidence review
> “In Asian studies, loss of HBsAg has been associated with a lower risk of HCC, especially when it occurs before the age of 50, compared to individuals who do not achieve HBsAg loss.”
> “A systematic review also showed that HBsAg loss correlates with lower rates of incident cirrhosis, hepatic decompensation, and overall and liver-related mortality, though there was substantial heterogeneity across studies for all outcomes.”
> “An additional benefit of HBsAg loss is the possibility of discontinuing NA therapy.”
> “A recent study has highlighted the importance of functional cure, which is rarely achieved with current therapies, in reducing social stigma and self-stigma and significantly improving the HRQoL of individuals living with HBV.”
Source: [EASL (2025)](https://doi.org/10.1016/j.jhep.2025.03.018)
###### Durability of HBsAg loss and hepatocellular carcinoma incidence: meta-analysis
> “Thirty‐eight studies and 43,924 patients were finally included. The results showed that HBsAg seroclearance was durable, with a pooled recurrence rate of 6.19% (95% CI: 4.10%–8.68%).”
> “Anti‐HBs seroconversion resulted in a significantly reduced recurrence rate (RR = 0.25, p < .001). Patients who experienced HBsAg seroclearance had significantly lower HCC incidence than HBsAg‐positive (RR = 0.41, p < .001). The pooled HCC incidence after HBsAg seroclearance was 1.88%; this rate was reduced to 0.76% among patients without baseline cirrhosis.”
Source: [Song et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC7986681/)
###### HBsAg loss and clinical outcomes in a U.S. cohort
> “In total, 15,760 patients with chronic HBV infection were included; 5.6% were receiving stable antiviral treatment. Overall, 4.2% (n = 667) experienced HBsAg loss across the study period. HBsAg loss was associated with an 89% and 62% reduced risk of hepatocellular carcinoma (HCC; adjusted hazard ratio [aHR]: 0.11, 95% CI: 0.01–0.76) and all‐cause mortality (ACM; aHR: 0.38, 95% CI: 0.20–0.74), respectively. Risks of compensated cirrhosis (aHR: 0.84, 95% CI: 0.52–1.35) and decompensated liver disease (aHR: 0.74, 95% CI: 0.37–1.48) were lower after HBsAg loss, but did not reach significance.”
Source: [Drysdale et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13179525/)
###### Residual hepatocellular carcinoma risk after HBsAg loss
> “For individuals who have cleared HBsAg, one study reported an annual HCC incidence of 0.86% overall, 2.42% in those with cirrhosis, 0.43% in those without cirrhosis, 1.07% for males, 0.57% for females, 1.21% if ≥50 years, and 0.33% if <50 years”
> “In a meta-analysis of 24 studies of 33,838 persons who cleared HBsAg, the pooled proportions of HCC occurrence ranged from 0.35% to 0.78% per year following treatment-induced or spontaneous HBsAg loss, respectively.”
Source: [Ghany et al. (2026)](https://doi.org/10.1097/HEP.0000000000001549)
> “Although progression of liver disease to cirrhosis or hepatic decompensation generally stops when patients lose HBsAg unless other causes of liver injury are present (eg, heavy alcohol consumption or nonalcoholic fatty liver), the risk of HCC persists, particularly if HBsAg loss occurred in patients older than 50 years or in those with cirrhosis or coinfection with HCV or hepatitis D virus (HDV) (128, 130–132).”
Source: [Terrault et al. (2018)](https://pmc.ncbi.nlm.nih.gov/articles/PMC5975958/)
###### Bepirovirsen: expected off-treatment response and durability through week 96
> “At Week 72, 24 weeks after stopping NrtI therapy, 79% (233/295) of these participants met the primary endpoint. Of the 233 participants who met the primary endpoint at Week 72, 91% (211/233) maintained response off all HBV treatment at Week 96.”
> “Through Week 96, among the 84 HIBSAGO recipients who discontinued NrtI therapy but did not achieve the primary endpoint at Week 72 (62 participants) or who achieved the primary endpoint but did not maintain a sustained response at Week 96 (22 participants), one participant met criteria to restart NrtI therapy.”
> “Out of the 84 participants, three additional participants restarted NrtI therapy within one month of NrtI cessation without having met the protocol-defined NrtI restart criteria.”
Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF)
###### Bepirovirsen: proportion able to stop existing therapy and off-treatment control
> “Across the two trials, 24% of patients who received Hibsago met the requirements to stop their existing medicine, compared with none who received placebo. Twenty-four weeks after stopping all hepatitis B treatment, 19% of patients who received Hibsago still had the virus under control, and a protein that signals hepatitis B infection (HBsAg) could not be detected in their blood.”
Source: [FDA Hibsago approval announcement (2026)](https://www.fda.gov/news-events/press-announcements/fda-approves-first-its-kind-chronic-hepatitis-b-treatment)
###### Bepirovirsen: HBsAg reduction to 100 IU/mL or less at week 72
> “Exploratory analyses also showed bepirovirsen reduced HBsAg to ≤100 IU/ml in 49% of participants (598 of 1220) in the overall study population, and in 62% of bepirovirsen recipients in the ≤1000 IU/ml (476 of 768) sub-group”
Source: [GSK press release, Hibsago US approval (2026)](https://www.gsk.com/en-gb/media/press-releases/hibsago-bepirovirsen-approved-in-the-us-for-the-treatment-of-chronic-hepatitis-b-chb/)
Additional sources: [Lok (2026)](https://pubmed.ncbi.nlm.nih.gov/42206569/); [Kim et al. (2014)](https://pubmed.ncbi.nlm.nih.gov/24162593/)
## Related pages
- [Hibsago (bepirovirsen): Chronic hepatitis B virus infection in adults without cirrhosis](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis.md)
- [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Terms and abbreviations](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/terms-and-abbreviations) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/terms-and-abbreviations.md)
- [Hibsago (bepirovirsen): Chronic hepatitis B virus infection in adults without cirrhosis](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/executive-summary) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/executive-summary.md)
- [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Clinical evidence](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/clinical-evidence) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/clinical-evidence.md)
- [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Economic information and modeling report](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/economics) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/economics.md)
- [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: References](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/references) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/references.md)
- [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: new drug review](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/monograph/review) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/monograph/review.md)
- [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: cost-effectiveness analyses and utility weights](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/cost-effectiveness-analyses) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/cost-effectiveness-analyses.md)