--- title: "Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Mechanism of action" description: "Formulary evidence on Hibsago (bepirovirsen, GSK3228836) in Chronic hepatitis B virus infection in adults without cirrhosis: Mechanism of action. Topics: Pharmacologic class: HBV messenger RNA-directed antisense oligonucleotide, Gapmer chemistry and RNase H1-mediated degradation of HBV RNA, Binding site sequence and RNase H cleavage: phase 2a publication, Target in transcripts from integrated HBV DNA: HBeAg-negative participants, and 7 further topics. 11 evidence topics quoted from 5 sources." canonical: "https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/product-information-and-disease-description/mechanism-of-action" published: "2026-10-21T22:39:04-04:00" modified: "2026-10-22T19:07:03-04:00" --- # Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Mechanism of action ## 2.1.2.6.1 Mechanism of Action ### Pharmacologic class: HBV messenger RNA-directed antisense oligonucleotide > “HIBSAGO (bepirovirsen) injection is a hepatitis B virus (HBV) messenger RNA-directed antisense oligonucleotide.” > “HIBSAGO is an antiviral drug against HBV [see Microbiology (12.4)].” Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF) ### Gapmer chemistry and RNase H1-mediated degradation of HBV RNA > “Bepirovirsen is a synthetic, single-stranded, chimeric antisense oligonucleotide (ASO) with a gapmer architecture consisting of five 2′-O-(2-methoxyethyl) (2′-MOE)-modified ribonucleotide wings flanking a central 10-deoxynucleotide gap with phosphorothioate linkages throughout.” > “Bepirovirsen is designed to bind a conserved 20-nucleotide site” > “present in HBV mRNAs (including the pregenomic RNA [pgRNA], precore, preS1, preS2/S, and X mRNAs), forming a DNA:RNA heteroduplex that recruits endogenous ribonuclease H1 (RNase H1) to catalyze irreversible hydrolysis of the viral RNA strand at the 3’-O-P bonds, resulting in degradation of HBV mRNA and reduction in HBV DNA and viral proteins, including HBsAg.” > “The 20-nucleotide binding site is present within transcripts derived from both cccDNA and integrated HBV DNA.” Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF) ### Binding site sequence and RNase H cleavage: phase 2a publication > “Bepirovirsen (previously ISIS 505358; GSK3228836) is an antisense oligonucleotide (ASO) with a 2′-O-methoxyethyl (2′-MOE) gapmer design (full sequence is publicly available)13.” > “The bepirovirsen binding site (GCACTTCGCTTCACCTCTGC) is present in all HBV mRNA and pregenomic RNA; as such, bepirovirsen would be expected to reduce levels of all HBV mRNAs including pregenomic RNA.” > “Specific ASOs bind to complementary HBV RNA transcripts forming a hybrid ASO/RNA complex, which recruits endogenous RNase H, cleaving the HBV RNA and leading to degradation of the transcript.” Source: [Yuen et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8516644/) ### Target in transcripts from integrated HBV DNA: HBeAg-negative participants > “The substantial reduction of HBsAg in HBeAg-negative patients suggests that the bepirovirsen target site is preserved in the majority of transcripts derived from integrated HBV genomes.” Source: [Yuen et al. (2021)](https://pmc.ncbi.nlm.nih.gov/articles/PMC8516644/) ### Conservation of the target site across HBV genotypes > “Conservation of the bepirovirsen target site across HBV genotypes indicates broad antiviral activity.” > “Bioinformatic analysis of 9,139 HBV genomes in the HBV database showed that the target sequence is conserved across genotypes A-H and recombinant forms, with full identity to 97.6% of sequences, and to 99.7% of sequences when allowing for one nucleotide mismatch.” Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF) ### Antiviral activity in cell culture > “Bepirovirsen reduced the level of HBV RNA transcripts in a dose-dependent manner in HepG2.2.15 cells (HBV genotype D) using transfection-based delivery resulting in EC50 values of 70 nM (16 hours) and 122 nM (48 hours) as measured by two RT-qPCR primer/probe sets targeting pgRNA, preS1, and preS2/S mRNAs.” > “In HepG2.2.15 cells (HBV genotype D, transfection-based delivery), bepirovirsen reduced intracellular HBV DNA with EC50 values of approximately 171 nM and 53 nM by qPCR at 48 and 96 hours, respectively, and inhibited extracellular HBsAg and HBeAg secretion with EC50 values of approximately 138 nM and 296 nM by ELISA at 48 hours, respectively.” > “In primary human hepatocytes (HBV genotype D, free uptake), 4 doses of bepirovirsen every ~72 to 96 hours inhibited extracellular HBsAg and HBeAg secretion with EC50 values of 47.1±0.7 nM and 29.8±2.9 nM, respectively, as assessed by ELISA ~96 hours after the last dose.” > “Bepirovirsen inhibited extracellular HBsAg with an EC50 value of approximately 0.20–0.30 nM by chemiluminescent immunoassay (HBV genotype A; at ~96 hours) and reduced intracellular HBV DNA by approximately 3.5 to 5 log10 across genotypes A, B, C, and D by qPCR (at ~48 hours) at a fixed molar ratio.” Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF) ### Combination with nucleos(t)ide analogues in cell culture > “Combining bepirovirsen with entecavir or tenofovir disoproxil fumarate in HepG2.2.15 cells (HBV genotype D, transfection-based delivery) resulted in no antagonism and greater reductions of intracellular HBV DNA by qPCR compared to the individual drugs.” Source: [Hibsago prescribing information (2026)](https://gskpro.com/content/dam/global/hcpportal/en_US/Prescribing_Information/Hibsago/pdf/HIBSAGO-PI-MG-IFU.PDF) ### Unconjugated design and uptake by non-parenchymal liver cells > “Bepirovirsen is unconjugated,6 in contrast to small-interfering RNAs currently in development, which are conjugated to a N-acetylgalactosamine (GalNAc) for targeted delivery to hepatocytes.7 This unconjugated design may facilitate delivery to and uptake by a broader range of cells within the liver, including non-parenchymal cells, such as liver-resident macrophages (Kupffer cells) and endothelial cells.8” > “Notably, bepirovirsen demonstrated superior efficacy to GSK3389404, its GalNAc-conjugate, in phase II clinical trials, suggesting a possible advantage in engaging a broader array of liver cells.4,10” Source: [Ermler et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13482607/) ### Innate immune activation through human TLR8 as a second mechanism > “Clinical and preclinical data demonstrate that bepirovirsen elicits an innate immune response, evidenced by induction of inflammatory cytokines. This effect is mediated at least in part by TLR8 activation, complementing its established antiviral mechanism.” > “This study demonstrates that bepirovirsen can induce an innate immune response, likely through TLR8 agonism, in addition to its known antiviral mechanism; however, the clinical impact of this immunomodulatory effect remains unclear and requires further investigation.” Source: [Ermler et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC13482607/) ### Three proposed effects on HBV infection > “Bepirovirsen binds to a complementary sequence present in all HBV messenger RNA transcripts and targets all HBV RNAs (including pregenomic RNA), impacting HBV infection in 3 ways: reductions in viral proteins, including HBsAg; reductions in HBV DNA; and stimulation of the immune system, potentially via Toll‐like receptor 8 activation.” Source: [Han et al. (2025)](https://pmc.ncbi.nlm.nih.gov/articles/PMC11975176/) ### Immune-mediated killing of infected hepatocytes: B-Together biomarker analysis > “These findings provide evidence that bepirovirsen may modulate the immune system to facilitate infected hepatocyte killing in chronic HBV infection in addition to its direct antiviral effects; therefore, ALT increases could reflect a therapeutic response to bepirovirsen.” Source: [Joshi et al. (2026)](https://pmc.ncbi.nlm.nih.gov/articles/PMC12923464/) ## Related pages - [Hibsago (bepirovirsen): Chronic hepatitis B virus infection in adults without cirrhosis](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis.md) - [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Terms and abbreviations](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/terms-and-abbreviations) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/terms-and-abbreviations.md) - [Hibsago (bepirovirsen): Chronic hepatitis B virus infection in adults without cirrhosis](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/executive-summary) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/executive-summary.md) - [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Product information and disease description](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/product-information-and-disease-description) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/product-information-and-disease-description.md) - [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Clinical evidence](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/clinical-evidence) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/clinical-evidence.md) - [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: Economic information and modeling report](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/economics) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/economics.md) - [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: References](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/references) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/references.md) - [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: new drug review](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/monograph/review) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/monograph/review.md) - [Hibsago (bepirovirsen) in Chronic hepatitis B virus infection in adults without cirrhosis: cost-effectiveness analyses and utility weights](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/cost-effectiveness-analyses) · [Markdown](https://www.evicenter.com/drugs/hibsago--chronic-hepatitis-b-virus-infection-in-adults-without-cirrhosis/cost-effectiveness-analyses.md)