Section 3 of 6
Product information and disease description
399 evidence topics · 139 sources
Product description
Phase of product development
Regulatory status: Approved; NDA submitted in the first quarter of 2026 and approved October 2026
| Field | Quoted record |
|---|---|
| Drug name | “Hibsago” |
| Active ingredient | “bepirovirsen” |
| Approval date | “10/20/2026” |
Launch: Anticipated before the end of 2026
FDA approval on 20 October 2026
Expedited programs named at approval
Evidence supporting approval
Priority review and PDUFA goal date, April 2026
Breakthrough therapy designation, first quarter of 2026
Fast track designation, February 2024
Phase 3 B-Well trials: initiation in February 2023
Phase 3 B-Well trials: topline results in January 2026
Japan: application accepted in February 2026
Japan: SENKU designation, August 2024
Japan: approval on 24 August 2026
European Union: marketing authorisation application accepted in March 2026
China: application accepted in March 2026
China: breakthrough therapy designation in August 2021 and priority review in April 2026
Anticipated regulatory decisions outside the United States
| Anticipated pipeline milestone | Event | Timing |
|---|---|---|
| United States and Japan | “Regulatory decision (US, JP)” | “H2 2026” |
| European Union and China | “Regulatory decision (EU, CN)” | “H1 2027” |
Licensing from Ionis Pharmaceuticals, August 2019
Product information
Generic, brand name and therapeutic class of product
Developer: Ionis Pharmaceuticals
Development codes and former names
Therapeutic class: first antisense oligonucleotide approved for chronic hepatitis B
Therapeutic class: company descriptions at approval
Chemical class: 2′-O-(2-methoxyethyl) gapmer antisense oligonucleotide
Chemical description: salt form, molecular formula, and molecular weight
| Field | Quoted record |
|---|---|
| Name | “Bepirovirsen sodium (JAN/USAN)” |
| Trade name | “Hibsago (TN)” |
| CAS number | “2563929-84-8” |
Dosage forms and strengths
Package and national drug code
Solution, excipients, and latex
Storage before and after dispensing
Material safety data sheet
No evidence found.
Average sales price and wholesale acquisition cost
Wholesale acquisition cost published at or after approval
No evidence found.
Company statement on the timing of the U.S. list price
Royalties payable to Ionis on net sales
Average sales price
No evidence found.
Japan National Health Insurance price listing, October 2026
“新医薬品一覧表（令和８年１０月１４日収載予定）” (opens the source at this quote in a new tab)
“ヒブサーゴ皮下注１５０ｍｇシリンジ（１５０ｍｇ１ｍＬ１筒）” (opens the source at this quote in a new tab)
“１５０ｍｇ１ｍＬ１筒 １８３，０１５円” (opens the source at this quote in a new tab)
“製造販売承認日 令和８年８月２４日 薬価基準収載予定日 令和８年１０月１４日” (opens the source at this quote in a new tab)
“最初に承認された国（年月）：日本” (opens the source at this quote in a new tab)
Japan price calculation method and absence of a comparator
Japan cost accounting components of the listed price per 150 mg syringe
| Component | Value |
|---|---|
| Total product cost | “１３０，７３３円” |
| Operating profit | “２４，１６４円”“（流通経費を除く価格の１５．６％）” |
| Distribution cost | “１１，４８０円”“（消費税を除く価格の６．９％）” |
| Consumption tax | “１６，６３８円” |
| Price before and after premiums | “１８３，０１５円 → １８３，０１５円” |
Japan price premiums assessed and premium coefficient of zero
Japan price maintenance premium and cost-effectiveness evaluation designation
Japan standard drug cost per administration for inpatient DPC payment
American hospital formulary service (AHFS), or other drug classification
AHFS classification
No evidence found.
ATC classification
No evidence found.
USP category and class
No evidence found.
Pharmacologic class stated in the prescribing information
KEGG DRUG classification
| Field | Quoted record |
|---|---|
| Efficacy | “Antiviral” |
| Type | “Antisense oligonucleotide” |
| Comment | “Treatment of hepatitis B virus (HBV) infection” |
| Target | “HBV mRNA” |
| Brite hierarchy, level 1 | “Antimicrobials” |
| Brite hierarchy, level 2 | “Antivirals” |
| Brite hierarchy, level 3 | “Polyprotein cleavage inhibitor” |
| Brite hierarchy, level 4 | “HBV mRNA antisense” |
Therapeutic category of drugs in Japan
| Field | Quoted record |
|---|---|
| Therapeutic category code | “6250” |
| Category, level 1 | “Agents against pathologic organisms and parasites” |
| Category, level 2 | “Chemotherapeutics” |
| Category, level 3 | “Antivirals” |
Indication
U.S. indication: full prescribing information
U.S. indication: Highlights of prescribing information
U.S. indication: FDA-approved use on the novel drug approvals list
U.S. indication: FDA plain-language description
U.S. indication: patient information wording
Baseline HBsAg testing required for patient selection
Populations excluded from or not studied under the indication
Japan indication
Pharmacology
Mechanism of action
Pharmacologic class: HBV messenger RNA-directed antisense oligonucleotide
Gapmer chemistry and RNase H1-mediated degradation of HBV RNA
Binding site sequence and RNase H cleavage: phase 2a publication
“Bepirovirsen (previously ISIS 505358; GSK3228836) is an antisense oligonucleotide (ASO) with a 2′-O-methoxyethyl (2′-MOE) gapmer design (full sequence is publicly available)13.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The bepirovirsen binding site (GCACTTCGCTTCACCTCTGC) is present in all HBV mRNA and pregenomic RNA; as such, bepirovirsen would be expected to reduce levels of all HBV mRNAs including pregenomic RNA.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Specific ASOs bind to complementary HBV RNA transcripts forming a hybrid ASO/RNA complex, which recruits endogenous RNase H, cleaving the HBV RNA and leading to degradation of the transcript.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Target in transcripts from integrated HBV DNA: HBeAg-negative participants
Conservation of the target site across HBV genotypes
Antiviral activity in cell culture
Combination with nucleos(t)ide analogues in cell culture
Unconjugated design and uptake by non-parenchymal liver cells
“Bepirovirsen is unconjugated,6 in contrast to small-interfering RNAs currently in development, which are conjugated to a N-acetylgalactosamine (GalNAc) for targeted delivery to hepatocytes.7 This unconjugated design may facilitate delivery to and uptake by a broader range of cells within the liver, including non-parenchymal cells, such as liver-resident macrophages (Kupffer cells) and endothelial cells.8” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Notably, bepirovirsen demonstrated superior efficacy to GSK3389404, its GalNAc-conjugate, in phase II clinical trials, suggesting a possible advantage in engaging a broader array of liver cells.4,10” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Innate immune activation through human TLR8 as a second mechanism
“Clinical and preclinical data demonstrate that bepirovirsen elicits an innate immune response, evidenced by induction of inflammatory cytokines. This effect is mediated at least in part by TLR8 activation, complementing its established antiviral mechanism.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“This study demonstrates that bepirovirsen can induce an innate immune response, likely through TLR8 agonism, in addition to its known antiviral mechanism; however, the clinical impact of this immunomodulatory effect remains unclear and requires further investigation.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Three proposed effects on HBV infection
“Bepirovirsen binds to a complementary sequence present in all HBV messenger RNA transcripts and targets all HBV RNAs (including pregenomic RNA), impacting HBV infection in 3 ways: reductions in viral proteins, including HBsAg; reductions in HBV DNA; and stimulation of the immune system, potentially via Toll‐like receptor 8 activation.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Immune-mediated killing of infected hepatocytes: B-Together biomarker analysis
“These findings provide evidence that bepirovirsen may modulate the immune system to facilitate infected hepatocyte killing in chronic HBV infection in addition to its direct antiviral effects; therefore, ALT increases could reflect a therapeutic response to bepirovirsen.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Pharmacodynamics
Exposure-response relationship in B-Well 1 and B-Well 2
Immunostimulant activity: nonclinical studies in the prescribing information
Immune markers in clinical studies: prescribing information
TLR8 reporter cell lines and hTLR8 transgenic mice
“Analysis of innate immune activation in PRR-overexpressing cells revealed a weak but statistically significant (p = 0.00085) induction only in the presence of human Toll-like receptor 8 (TLR8). In hTLR8 transgenic mice – but not wild-type mice – bepirovirsen treatment induced pro-inflammatory cytokines, similar to the TLR8 agonist selgantolimod. Kupffer cells and macrophages were identified as the primary responders to bepirovirsen in the livers of hTLR8 mice.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Notably, induction of type I IFN (IFN-α or IFN-β) did not occur with bepirovirsen in hTLR8 mice.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Cytokine induction in the phase 2a study
“At 24 h following bepirovirsen treatment (Fig. 1B), key cytokines known to regulate pro-inflammatory and antiviral processes, such as IFN-γ and TNF, as well as others that induce macrophage and neutrophil (CCL2, CCL4, CSF1, CSF3) or T cell (IL-12B, CCL19) recruitment and activation, were among the upregulated analytes in bepirovirsen-treated individuals.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Compared with the non-responder group, the responder group showed trends towards increased activity in the IFN-γ signaling and T-cell response pathways.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Innate immune proteins in healthy volunteers and participants with chronic HBV infection
“Bepirovirsen induced significant, transient protein differential expression in the hours after dosing, while there were relatively minor changes in placebo. There were many similarities in protein biomarkers induced in CS3 participants with chronic HBV infection and in the two healthy volunteer studies. Additionally, bepirovirsen treatment increased abundance of many proteins to a higher degree with increasing dose.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“These findings strengthen the association between bepirovirsen treatment and changes in innate immune-related proteins and indicate that this effect does not require the presence of HBV.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Serum proteomics and transcriptomics in B-Together
“Increases from baseline in mean expression of serum proteins with immune effector and apoptotic functions (Week 3) and transcripts associated with immune cell proliferation and activation (Week 5) were observed regardless of arm or response subgroup. By Week 8, serum liver and apoptosis-specific proteins were increased; this was more pronounced in responders than non-responders, with the difference more marked in Arm 1 versus Arm 2. Increased abundance of these proteins was highly correlated with ALT levels, which were often associated with transient hepatitis B virus (HBV) DNA elevations and HBsAg decreases.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
HBsAg and HBV DNA reduction after 4 weeks of treatment: phase 2a study
“For treatment-naïve patients, the mean (s.d.) HBsAg reduction from baseline to day 29 was 0.50 (0.57) log10 IU ml−1 (P = 0.245 versus placebo) and 1.56 (1.38) log10 IU ml−1 (P = 0.001 versus placebo) in the bepirovirsen 150 mg and 300 mg arms, respectively (Table 3). For on-NA patients, the mean (s.d.) HBsAg reduction to day 29 was 1.99 (1.80) log10 IU ml−1 (Table 3). By contrast, no placebo-treated patient had a reduction in HBsAg of >0.07 log10 IU ml−1 by day 29.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The mean (s.d.) HBV DNA reduction from baseline to day 29 was 0.38 (0.42) log10 IU ml−1 (P = 0.116 versus placebo) and 1.66 (1.48) log10 IU ml−1 (P < 0.001 versus placebo) in the bepirovirsen 150 mg and 300 mg arms, respectively (Table 3).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
HBsAg decline during 24 weeks of treatment: B-Clear
Week 12 HBsAg below 1 IU/mL as an early on-treatment marker
ALT flares temporally associated with HBsAg decline
“Reductions in HBsAg either preceded the ALT increases or occurred concomitantly with ALT flares (Fig. 3a–d and Supplementary Fig. 4). Generally, larger ALT increases (based on peak ALT) were associated with greater HBsAg reductions (Fig. 3e and Supplementary Fig. 6).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“By contrast, no ALT flares were observed in patients without a HBsAg reduction (<0.2 log10) or in patients receiving placebo.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
ALT increases to at least 3 times the upper limit of normal: B-Clear
C-reactive protein increases after the first dose
“Six (50%) bepirovirsen‐treated participants in the single‐dose cohorts and 9 (100%) in the multiple‐dose cohorts had transient increases in C‐reactive protein (CRP) (single‐dose, Figure S11A; multiple‐dose, Figure 3A–D).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Peak CRP levels ranged from 4.2 to 53.3 mg/L; those with peak CRP levels >10 mg/L (n = 5 for single‐dose; n = 6 for multiple‐dose) were reported as treatment‐emergent AEs. These increases were not associated with symptoms, and no participants had chronic CRP elevation.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“An increase in C-reactive protein (CRP) levels following the first dose of bepirovirsen was observed in patients with CHB.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“CRP elevations were dose-related in patients and were consistent with those observed in healthy volunteers (Supplementary Fig. 3b and unpublished data).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Placebo-corrected QTcF change at Cmax: thorough QT study
| Arm | Participants analyzed | Placebo-corrected change from baseline in QTcF, geometric mean (90% CI), milliseconds |
|---|---|---|
| Bepirovirsen, four subcutaneous injections | “5” | “2.360”“(-0.249 to 4.970)” |
| Bepirovirsen, three subcutaneous injections | “18” | “2.024”“(-0.541 to 4.589)” |
Response by HBV genotype and baseline HBsAg in B-Well 1 and B-Well 2
Resistance: binding-site polymorphisms in B-Well 1 and B-Well 2
| Trial and baseline HBsAg stratum | Baseline nucleotide polymorphisms, % (n/N) | Treatment-emergent nucleotide mutations, % (n/N) |
|---|---|---|
| B-Well 1, baseline HBsAg ≤3,000 IU/mL | “6 (7/123)” | “5 (2/42)” |
| B-Well 2, baseline HBsAg ≤3,000 IU/mL | “7 (7/104)” | “6 (2/31)” |
| B-Well 1, baseline HBsAg ≤1,000 IU/mL | “3 (2/69)” | “5 (1/22)” |
| B-Well 2, baseline HBsAg ≤1,000 IU/mL | “12 (6/50)” | “0 (0/10)” |
Resistance: phenotypic susceptibility of binding-site variants
Resistance: binding-site polymorphisms and response in B-Clear
Cross-resistance with nucleos(t)ide analogue reverse transcriptase inhibitors
Preclinical pharmacology: HBV-transgenic mice and human dose prediction
“Bepirovirsen dose‐dependently reduced hepatic expression of HBV RNA in HBV transgenic mice, with a maximal reduction >90% achieved following a dose of 50 mg/kg/week (Figure S4A).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Maximal reduction of serum HBsAg was ≈99% (2 logs).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The preclinical transgenic mouse model showed that the 90% effective dose for HBsAg reduction was ≈20 mg/kg, which corresponds to a plasma PK exposure equivalent dose of 280 mg (4 mg/kg) of bepirovirsen in humans.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Pharmacokinetics
Pharmacokinetic properties of bepirovirsen 300 mg: prescribing information
Basis of the values in the pharmacokinetic properties table
Covariates: race, ethnicity, age, sex, body weight, injection site, and anti-drug antibodies
Immunogenicity: anti-drug antibodies and clearance
Single and multiple doses in healthy volunteers: absorption, distribution, and elimination
“Following a single SC injection in all cohorts at all dose levels, the concentration‐time profile of bepirovirsen featured a rapid absorption phase, followed by an initial rapid distribution phase and a slower elimination phase (Figure 2). Median bepirovirsen tmax ranged from 3 to 8 hours after dosing across all cohorts and study days (Table 1).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Following a single SC injection of bepirovirsen, Cmax and total exposure, expressed as the AUC, increased with increasing dose (Table 1) and appeared to be dose proportional between 150 mg and 450 mg but were lower than dose proportional between 75 mg and 150 mg (Table 1).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Following the final dose on study day 22, the mean terminal plasma elimination half‐life was 22.4 to 24.2 days across cohorts.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Within the first 24 hours after dosing, urinary excretion of intact full‐length bepirovirsen accounted for <2% of the administered dose across all dose levels evaluated.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Plasma parameters of the 300 mg cohorts in healthy volunteers
| Cohort and study day | Cmax (µg/mL), mean (SD) | tmax (h), median (range) | AUC0-24h (µg • h/mL), mean (SD) | CL/F (L/h), mean (SD) | t1/2 (days), mean (SD) |
|---|---|---|---|---|---|
| Single dose 300 mg, day 1 | “9.47 (0.34)”View highlighted excerpt for this quote | “8 (6–8)”View highlighted excerpt for this quote | “112 (5.71)”View highlighted excerpt for this quote | “2.50 (0.13)”View highlighted excerpt for this quote | “NA”View highlighted excerpt for this quote |
| Multiple dose 300 mg, day 1 | “9.25 (2.13)”View highlighted excerpt for this quote | “6 (4–8)”View highlighted excerpt for this quote | “123 (3.04)”View highlighted excerpt for this quote | “NA”View highlighted excerpt for this quote | “NA”View highlighted excerpt for this quote |
| Multiple dose 300 mg, day 22 | “7.93 (2.23)”View highlighted excerpt for this quote | “6 (4–8)”View highlighted excerpt for this quote | “103 (19.4)”View highlighted excerpt for this quote | “2.03 (0.21)”View highlighted excerpt for this quote | “24.2 (6.06)”View highlighted excerpt for this quote |
Population pharmacokinetic model: phase 1, 2a, and 2b data
“Bepirovirsen PK data were well-described by a linear, three-compartment model with first-order absorption and absorption delay. Chronic HBV infection status, body weight, and Asian versus non-Asian race were key covariates included in the final model.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In simulations, bepirovirsen systemic exposure was dosed proportionally and predicted to be almost completely washed out by 12 weeks following the final 300-mg dose. Differences in body weight, Asian race, or disease status did not result in clinically relevant differences in exposure.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The lack of clinically relevant differences seen in exposure indicate that dose adjustments are not recommended for bepirovirsen based on demographics or clinical characteristics.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Population pharmacokinetic model: effect of body weight and washout after 24 weeks
“When body weight increased from 40 to 100 kg, the median (90% CI) for AUCtau decreased from 131.0 (78.4, 209.0) to 83.2 µg·h/ml (49.8, 133.0), Cmax reduced from 12.5 (6.3, 23.2) to 6.6 µg/ml (3.4, 11.9), and Ctrough from 0.0383 (0.0217, 0.0686) to 0.0160 µg/ml (0.0090, 0.0289). However, the ranges were not considered clinically relevant.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In participants who received bepirovirsen 300 mg weekly for 24 weeks, the median (95% CI) predicted concentration at week 36 was 93% lower than at the end of treatment (week 24: 0.0224 [0.0113, 0.0461] µg/ml versus week 36: 0.0017 [0.000048, 0.0102] µg/ml).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Relative bioavailability of the vial and the prefilled syringe
“Analysis of the primary endpoint demonstrated the bioequivalence of bepirovirsen exposure from a vial versus PFS SSD when HCP‐administered, as the GMR (90% CI) was 1.02 (0.91, 1.14) for Cmax and 1.05 (0.96, 1.15) for AUC(0‐inf) (Table 3).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The GMR (90% CI) with participant training (Group 2 versus Group 3) was 1.02 (0.88, 1.18) for Cmax and 0.98 (0.88, 1.09) for AUC(0‐inf), and without participant training (Group 2 versus Group 4) was 0.99 (0.87, 1.13) for Cmax and 0.97 (0.87, 1.08) for AUC(0‐inf).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Body weight and injection site: single 300 mg dose in healthy participants
“The geometric mean bepirovirsen Cmax and AUC(0‐inf) decreased with increasing body weight. Between the 50‐<70kg and ≥80kg groups, there was a decrease of 24%‐47% in geometric mean Cmax and a decrease of 19%‐43% in geometric mean AUC(0‐inf).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Across all treatment groups the geometric mean Cmax of bepirovirsen tended to be lower when administered in the thigh compared with the other injection sites.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Liver distribution and intracellular sequestration
“Based on extrapolations from concentration measurements in preclinical species, the total liver concentration of bepirovirsen at steady state was estimated to be 34.8 µM, which seems, on first appearance, to be higher than the plasma. However, when the distribution between the hepatocytes and nonparenchymal cells is factored in, only 15% (5 µM) of the liver concentration is associated with the hepatocytes. Furthermore, multiple sources estimate that greater than 98% of the concentration of the drug in the hepatocytes is sequestered in the endo‐lysosomal system,” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Tissue localization in mice: liver and kidney
“Bepirovirsen was localized primarily in nonparenchymal liver cells and proximal renal tubules.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Positive liver signal was quantified using HALO AI, with 12.9% of the ASO localized to the hepatocytes and 87.1% in nonparenchymal cells.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Physiologically based pharmacokinetic model: predicted liver and kidney exposure
“Liver and kidney partition coefficients were calculated to be 2147 and 2822, respectively.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Predicted vs. observed clearance (L/h), AUC0-inf (µg.h/mL) and Cmax (µg/mL) for the 300 mg single dose in healthy volunteers were 2.94, 114.43, and 10.56 vs. 2.25, 136.6, and 6.5, respectively.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“The PBPK model predicted the liver and kidney tissue Cmax values to be 172 and 132 µg/mL, respectively.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Hepatic impairment: pharmacokinetics
Contraindications/Warnings/Precautions/Adverse effects
Warnings and precautions
Boxed warning: on-treatment hepatic flares
Boxed warning: thrombocytopenia
Contraindications: hepatic impairment, cirrhosis, and low platelet count
Warning: on-treatment hepatic flares
Warning: thrombocytopenia
Warning: worsening renal function
Warning: inflammatory and immune effects
Warning: serious adverse reaction with improper administration
Warning: exacerbations of hepatitis B after nucleos(t)ide analog discontinuation
Warning: HIV-1 virologic failure in HBV and HIV-1 coinfection
Warning: hepatitis flare in HBV and hepatitis D virus coinfection
Warning: unknown effect on preventing transmission of HBV
Safety population and discontinuations due to adverse events in B-Well 1 and B-Well 2
Adverse reactions reported in at least 3% of participants in B-Well 1 and B-Well 2, weeks 1 to 36
Adverse reaction definitions and less common adverse reactions
Injection site reactions in B-Well 1 and B-Well 2, weeks 1 to 36
| Injection site reaction (all grades) | Bepirovirsen, N = 1,223 | Placebo, N = 611 |
|---|---|---|
| Any injection site reaction | “57%” | “15%” |
| Injection site erythema | “32%” | “2%” |
| Injection site pain | “24%” | “6%” |
| Injection site pruritus | “19%” | “1%” |
| Injection site bruising | “19%” | “6%” |
| Injection site induration/swelling | “13%” | “1%” |
| Injection site discoloration | “8%” | “<1%” |
| Injection site rash | “6%” | “<1%” |
| Injection site hematoma | “4%” | “1%” |
Cutaneous vasculitis: biopsy-confirmed cases
Laboratory abnormalities worsened from baseline in B-Well 1 and B-Well 2, weeks 1 to 36
| Laboratory category | Bepirovirsen, N = 1,223 | Placebo, N = 611 |
|---|---|---|
| ALT ≥3x to <5x ULN | “10%” | “<1%” |
| ALT ≥5x to <10x ULN | “8%” | “0” |
| ALT ≥10x to <20x ULN | “4%” | “0” |
| ALT ≥20x ULN | “2%” | “<1%” |
| AST ≥3x to <5x ULN | “6%” | “<1%” |
| AST ≥5x to <10x ULN | “4%” | “<1%” |
| AST ≥10x to <20x ULN | “1%” | “<1%” |
| AST ≥20x ULN | “<1%” | “0” |
| Total bilirubin ≥ULN to <1.5x ULN | “8%” | “11%” |
| Total bilirubin ≥1.5x to <2x ULN | “2%” | “2%” |
| Total bilirubin ≥2x ULN | “<1%” | “<1%” |
| Platelets ≥100 to <140 x 10^9/L | “37%” | “7%” |
| Platelets ≥75 to <100 x 10^9/L | “8%” | “<1%” |
| Platelets ≥50 to <75 x 10^9/L | “2%” | “<1%” |
| Platelets ≥25 to <50 x 10^9/L | “<1%” | “0” |
| Platelets <25 x 10^9/L | “<1%” | “0” |
| ANC ≥500 to <1,000 cells/mm3 | “8%” | “3%” |
| ANC ≥100 to <500 cells/mm3 | “1%” | “<1%” |
| ANC <100 cells/mm3 | “0” | “0” |
| eGFR ≥15 to <30% decline from baseline | “51%” | “30%” |
| eGFR ≥30 to <50% decline from baseline | “17%” | “6%” |
| eGFR ≥50% decline from baseline | “1%” | “<1%” |
| uACR ≥0.3 mg/mg | “2%” | “1%” |
Laboratory abnormalities: ALT increases leading to treatment pause or discontinuation
Laboratory abnormalities: platelet count decreases
Laboratory abnormalities: neutrophil count decreases
Laboratory abnormalities: eGFR decreases
Pooled adverse events, serious adverse events, and grade 3 or higher adverse events
“In a pooled analysis at 72 weeks, adverse events were reported in 91% of the patients in the bepirovirsen groups and in 73% of those in the placebo groups; serious adverse events were reported in 7% and 4% of the patients, respectively. During the treatment period, adverse events of grade 3 or higher were reported in 16% of the patients who received bepirovirsen and in 3% of those who received placebo; increases in the alanine aminotransferase level were the most common grade 3 adverse events with bepirovirsen (in 6% of the patients).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Overdosage
Special populations
Pregnancy
Lactation
Pediatric development: European paediatric investigation plan
Geriatric use
Renal impairment: dedicated pharmacokinetic study
Hepatic impairment and cirrhosis
HIV-1 coinfection: continuation of nucleos(t)ide analogue therapy
HIV-1 coinfection: exclusion from the pivotal trials and an ongoing trial
Drug/Drug, drug/disease interactions
Effects of other drugs on bepirovirsen
Drug interaction studies and nucleos(t)ide analogue coadministration: prescribing information
Bepirovirsen exposure with and without entecavir or tenofovir: phase 2a study
No effect of nucleos(t)ide analogues on bepirovirsen pharmacokinetics
“Bepirovirsen plasma pharmacokinetic parameters and concentration–time profiles in patients with chronic HBV in the CS3 study (NCT02981602) were similar with or without ETV or TFV coadministration, indicating no effect of NA coadministration on bepirovirsen pharmacokinetics.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Bepirovirsen was not an in vitro substrate of MRP2, OATP1B1, OATP1B3, OAT1, OAT3, OCT1, OCT2, MATE1, or MATE2‐K.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Although reliable and meaningful efflux ratios could not be determined for P‐gp or BCRP, bepirovirsen is unlikely to be a substrate of P‐gp or BCRP efflux transporters.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“ASOs are not typically metabolized by CYP enzymes but are instead primarily metabolized by endonucleases and exonucleases or have been chemically modified to resist degradation.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Nucleos(t)ide analogue treatment status as a covariate in the population pharmacokinetic model
“Results of this PK analysis suggest that no dose adjustment should be recommended for bepirovirsen based on demographic or baseline characteristics, or according to nucleos(t)ide analogue treatment status.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Limitations of the drug interaction assessment
“Second, only the most common NAs used to treat chronic HBV infection (ETV and TFV) 3 were evaluated as perpetrator and victim in this analysis.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Third, the small sample size did not allow for any statistical comparison.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Effects of bepirovirsen on other drugs
Effect on nucleos(t)ide analogue exposure and on enzymes and transporters: prescribing information
Entecavir and tenofovir exposure during bepirovirsen coadministration: B-Clear
No effect of bepirovirsen on entecavir or tenofovir pharmacokinetics
“The analysis included 186 ETV plasma concentrations from 16 participants treated with bepirovirsen and ETV, 70 TFV plasma concentrations from 6 participants treated with bepirovirsen and TDF, and 70 TFV plasma concentrations from 5 participants treated with bepirovirsen and TAF. As summarized in Table 3, mean ETV and TFV Cmax and AUC values from participants in the B‐Clear study who received coadministration of bepirovirsen and NA (ETV, TDF, or TAF) were consistent with published data without coadministered bepirovirsen.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Thus, the analyses reported here showed no potential for DDI between bepirovirsen and ETV or TFV, substantiated by both in vitro assessments and clinical evaluation. Based on the totality of data, bepirovirsen Phase 3 studies were permitted by health authorities to proceed without conducting dedicated DDI studies.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
In vitro inhibition and induction of enzymes and transporters
“Bepirovirsen was not a clinically relevant reversible or time‐dependent inhibitor of CYP1A2, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, or CYP3A4/5 or a reversible inhibitor of UGT enzymes.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Bepirovirsen was an inducer of CYP3A4 in vitro in 1 of 3 cryopreserved human hepatocyte donors only, with unbound concentration causing half‐maximal induction effect and maximum induction effect values of 13.6 µM and 2.28‐fold, respectively (Table 1). The results of the basic static modeling indicate that bepirovirsen is not considered to be a CYP3A4 inducer of clinical DDI concern.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Bepirovirsen inhibited the MRP2 transporter in vitro with an IC50,u of 8.49 µM. Results of the basic static model predicted that bepirovirsen is not a clinically relevant inhibitor of MRP2.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The maximum unbound plasma concentration (Cmax), following the therapeutic subcutaneous dose of 300 mg, administered weekly for 24 weeks, was 57 nM.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Anticoagulants, antiplatelets, and drugs that decrease platelet count
Drug-disease interaction: hepatitis D virus coinfection and ALT increases
Dosing and administration
Dosage
Recommended dosage: loading phase and maintenance phase
Treatment duration and early cessation at week 12
Patient selection: quantitative HBsAg testing and baseline laboratory tests
Dosage modification by ALT and total bilirubin
Dosage modification by platelet count
Dosage modification by eGFR
| eGFR | Dosage | eGFR monitoring frequency |
|---|---|---|
| No significant change from baseline | “No dosage adjustment required” | “Monitor eGFR every other week through Week 24” |
| Reduced by ≥30% from pretreatment levels for ≥2 consecutive readings | “Pause treatment”“When eGFR increases to within 15% of pretreatment levels, resume treatment at 300 mg once a week.” | “Monitor weekly until eGFR stabilizes or returns to pretreatment levels” |
Completion of treatment: nucleos(t)ide analog continuation and criteria for stopping it
Administration
Route, supervised first dose, and self-administration
Prefilled syringe and needle
Preparation before injection
Injection sites, two-syringe dose, and site rotation
Storage and handling after dispensing
Instructions for Use: preparation, injection, and disposal steps
Patient counseling on administration technique
Self-administration with the prefilled syringe: relative bioavailability study
“Participants (N = 159) received a single 300 mg SC dose of bepirovirsen administered by a HCP (vial [n = 46] or PFS SSD [n = 49]), or self‐administered (PFS SSD, with [n = 32] or without [n = 32] training from a HCP).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The GMR (90% CI) with participant training (Group 2 versus Group 3) was 1.02 (0.88, 1.18) for Cmax and 0.98 (0.88, 1.09) for AUC(0‐inf), and without participant training (Group 2 versus Group 4) was 0.99 (0.87, 1.13) for Cmax and 0.97 (0.87, 1.08) for AUC(0‐inf).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The proportion of participants experiencing injection site reactions was higher when PFS SSD was self‐administered (Group 3: 32/32 [100%], Group 4: 30/32 [94%]) compared with HCP administration (Group 2: 43/49 [88%]).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“While 6 participants received an incomplete dose of bepirovirsen, owing to incorrect use of the PFS (4 of them injected approximately 75% to 95% of the dose), device usability was evaluated in separate formative and summative human factors studies, and the device and instructions for use were successfully validated for self‐administration (unpublished data).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Access and distribution
Access and patient support programs named at approval
Specialty pharmacy or distribution network
No evidence found.
Company contact and product website named in the labeling
Care setting: laboratory monitoring and first dose under healthcare provider supervision
Companion diagnostic for patient selection
Distribution in mainland China: collaboration with SBP Group
Co-prescribed/Concomitant therapies
Required nucleos(t)ide analog reverse transcriptase inhibitor therapy
Nucleos(t)ide analog therapy in B-Well 1 and B-Well 2: continuation, cessation, and restart
Nucleos(t)ide analogs used with bepirovirsen in clinical trials: entecavir and tenofovir
“Entecavir (ETV) and tenofovir (TFV) are the most commonly used NAs” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“NAs such as lamivudine and adefovir were used in only 4 of 227 (1.8%) On‐NA participants in B‐Clear.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“the NCA PK parameters from 5 subjects receiving TAF in the B‐Clear study were similar to the published data on TAF (Table 3).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Nucleos(t)ide analog therapy at baseline in B-Together
Pharmacokinetic interaction with entecavir and tenofovir
“Bepirovirsen plasma pharmacokinetic parameters and concentration–time profiles in patients with chronic HBV in the CS3 study (NCT02981602) were similar with or without ETV or TFV coadministration, indicating no effect of NA coadministration on bepirovirsen pharmacokinetics.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In patients with chronic HBV receiving both bepirovirsen and ETV or TFV in the B‐Clear study (NCT04449029), NA plasma concentrations and pharmacokinetic parameters were similar to those published without bepirovirsen coadministration, suggesting no effect of bepirovirsen coadministration on NA pharmacokinetics.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Antiviral activity in combination with entecavir or tenofovir and cross-resistance
Peginterferon alfa-2a: concomitant use not recommended
Antiretroviral therapy in HIV and HBV coinfection
Concomitant medications restricted in B-Well 1 and B-Well 2
Effect of bepirovirsen on quality measures
Medicaid Adult Core Set: Evaluation of Hepatitis B and C measure added for 2027
Evaluation of Hepatitis B and C measure: listing in the 2027 Adult Core Set
| Field | 2027 Adult Core Set |
|---|---|
| Reporting category | “2027 Voluntary Adult Core Set Measures” |
| Domain | “Primary Care Access and Preventive Care” |
| CMIT number | “1852” |
| Measure steward | “MODRN” |
| Measure name | “Evaluation of Hepatitis B and C (EHBC-AD)” |
| Data collection method | “Administrative” |
| Status | “This measure was added to the 2027 Adult Core Set.” |
Evaluation of Hepatitis B and C measure: reported rates, populations, and testing results
Viral hepatitis quality measures with a hepatitis B component in federal and commercial programs
Healthy People 2030 objective IID-13: awareness of chronic hepatitis B infection
| Field | Objective record |
|---|---|
| Objective | “Increase the proportion of persons aware they have chronic hepatitis B” |
| National baseline | “32.4 percent of persons with chronic hepatitis B were aware they have chronic hepatitis B in 2013-16” |
| National target | “90.0 percent” |
| National status | “Baseline only” |
| Data source | “National Health and Nutrition Examination Survey (NHANES), CDC/NCHS” |
Healthy People 2030 objective IID-15: deaths with hepatitis B as a cause
| Field | Objective record |
|---|---|
| Objective | “Reduce the rate of deaths with hepatitis B as the underlying or a contributing cause” |
| National baseline | “0.46 deaths with hepatitis B as the underlying or contributing cause of death per 100,000 population were reported in 2017” |
| Most recent data | “0.40 deaths with hepatitis B as the underlying or contributing cause of death per 100,000 population (2024)” |
| National target | “0.16 per 100,000” |
| National status | “Improving” |
Viral Hepatitis National Strategic Plan: hepatitis B core indicators and targets
CDC universal hepatitis B screening recommendation and national awareness goal
“HBV screening at least once during a lifetime for adults aged ≥18 years (new recommendation)” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“calls for an increase in the proportion of persons with HBV infection who are aware of their infection from 32% (2013–2016) to 90% by 2030” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Product-specific effect on quality measures
No evidence found.
Product comparison
Bepirovirsen: class, labeled regimen, and adverse reactions
Bepirovirsen against nucleos(t)ide analogue standard of care: functional cure rates
Bepirovirsen against placebo added to continued nucleos(t)ide analogue therapy: B-Well 1 and B-Well 2
“All the patients were receiving stable nucleoside or nucleotide analogue (NA) therapy and had an HBsAg level of more than 100 to 3000 IU per milliliter.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“The percentage of patients with a functional cure at week 72 was significantly higher with bepirovirsen than with placebo both in the B-Well 1 trial (in 127 of 650 patients [20%] vs. none of 328 patients) and in the B-Well 2 trial (in 106 of 570 patients [19%] vs. none of 286 patients).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Approved therapies: HBsAg loss rates cited in reports of investigational agents
“NAs effectively suppress HBV DNA but rarely achieve HBsAg loss (0–3% after long-term NA therapy), while IFN therapy is limited by safety and tolerability concerns” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Bepirovirsen has shown sustained HBsAg loss in approximately 9–10% of participants after 24 weeks of finite treatment” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
RNA-targeting agents in clinical development: dosing, common adverse events, and phase
“Dosing in latest clinical trials at the time of writing” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Common adverse events reported in latest clinical trials at the time of writing” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Combination regimens with RNA-targeting agents in clinical development
Bepirovirsen compared with siRNAs and a GalNAc-conjugated antisense oligonucleotide: mechanism and development stage
“Bepirovirsen is an unconjugated 20-mer ASO with a class II CpG motif that targets a conserved region in the HBV genome. Aside from its primary effect through complementary nucleotide binding, bepirovirsen can mediate TLR activity” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Bepirovirsen is now the only HBV RNAi therapeutic that has progressed to phase III clinical trials.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The efficacy of GSK3389404 was weaker than that of bepirovirsen.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The above trials demonstrated that single-agent siRNAs or ASOs cannot induce a high rate of functional cure in all patients.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Xalnesiran with or without an immunomodulator (Piranga phase 2): HBsAg loss 24 weeks after end of treatment
“We conducted a phase 2, multicenter, randomized, controlled, adaptive, open-label platform trial that included the evaluation of 48 weeks of treatment with xalnesiran at a dose of 100 mg (group 1), xalnesiran at a dose of 200 mg (group 2), xalnesiran at a dose of 200 mg plus 150 mg of ruzotolimod (group 3), xalnesiran at a dose of 200 mg plus 180 μg of pegylated interferon alfa-2a (group 4), or a nucleoside or nucleotide analogue (NA) alone (group 5)” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Among 159 participants (30, 30, 34, 30, and 35 in groups 1 through 5, respectively), the primary end-point event occurred in 7% (95% confidence interval [CI], 1 to 22) of those in group 1, in 3% (95% CI, 0 to 17) of those in group 2, in 12% (95% CI, 3 to 28) of those in group 3, in 23% (95% CI, 10 to 42) of those in group 4, and in none (95% CI, 0 to 10) of those in group 5.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“HBsAg loss with or without seroconversion occurred only in participants with a screening HBsAg level below 1000 IU per milliliter.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Xalnesiran with or without an immunomodulator (Piranga phase 2): grade 3 or 4 adverse events
“In groups 1 through 5, respectively, grade 3 or 4 adverse events occurred in 17%, 10%, 18%, 50%, and 6% of the participants, with the most frequent event being an elevated alanine aminotransferase level.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Xalnesiran-based regimens (Piranga phase 2): outcomes after nucleos(t)ide analogue discontinuation
“Among 121 participants, 58 (48%) met NA stopping criteria and 40 (33%) discontinued NA.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Among participants who remained off NA, five achieved and maintained HBsAg loss (HBsAg <0.05 IU/ml) and HBV DNA undetectable (HBV DNA <10 IU/ml); all were in treatment arms with an immunomodulator.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Of the 40 participants who discontinued NA, 19 (48%) experienced virological relapse (VR), three (8%) of whom further developed clinical relapse.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Elebsiran with pegylated interferon alfa against pegylated interferon alfa alone (ENSURE phase 2): HBsAg loss
“In part I (cohorts 1–3), virally suppressed participants with chronic HBV infection naive to BRII-179 were randomized 1:1:1 to receive 48 weekly doses of PEG-IFNα alone or in combination with 13 doses of elebsiran (200 mg or 100 mg) administered every 4 weeks.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In part I, at 24 weeks post-EOT, HBsAg loss was observed in 4 out of 19 (21.1%) participants receiving elebsiran 200 mg plus PEG-IFNα, 6 out of 18 (33.3%) participants receiving elebsiran 100 mg plus PEG-IFNα and 1 out of 18 (5.6%) participants receiving PEG-IFNα monotherapy.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In part II, HBsAg loss was observed in 9 out of 31 (29.0%) participants at 24 weeks post-EOT, with a higher response among BRII-179 anti-HBs responders (8 out of 19 participants, 42.1%) compared with nonresponders (1 out of 12 participants, 8.3%).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Elebsiran with pegylated interferon alfa against pegylated interferon alfa alone (ENSURE phase 2): adverse events
| Event | PEG-IFNα alone (cohort 1, N = 18) | Elebsiran 200 mg plus PEG-IFNα (cohort 2, N = 19) | Elebsiran 100 mg plus PEG-IFNα (cohort 3, N = 18) |
|---|---|---|---|
| Grade 3 adverse events, n (%) | “6 (33.3)”View highlighted excerpt for this quote | “6 (31.6)”View highlighted excerpt for this quote | “5 (27.8)”View highlighted excerpt for this quote |
| Grade 4 adverse events, n (%) | “2 (11.1)”View highlighted excerpt for this quote | “0”View highlighted excerpt for this quote | “1 (5.6)”View highlighted excerpt for this quote |
| Serious adverse events, n (%) | “2 (11.1)”View highlighted excerpt for this quote | “1 (5.3)”View highlighted excerpt for this quote | “0”View highlighted excerpt for this quote |
Elebsiran with or without pegylated interferon alfa-2a (phase 2): HBsAg seroclearance and ALT elevations
“Between July 2, 2020, and Nov 2, 2021, 124 individuals were screened for eligibility, 84 of whom were enrolled (15 in cohort 1, 15 in cohort 2, 18 in cohort 3, 18 in cohort 4, 13 in cohort 5, and five in cohort 6).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Six participants (one in cohort 2, three in cohort 4, and two in cohort 5) had sustained HBsAg seroclearance through to 24 weeks after the end of treatment. No participants receiving VIR-2218 monotherapy (cohort 1) or VIR-2218 plus pegylated interferon-alfa-2a 12-week regimen (cohort 6) had HBsAg seroclearance.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Two (13%) participants in cohort 1 had elevations in alanine aminotransferase, compared with 13 (87%) participants in cohort 2, 15 (83%) in cohort 3, 17 (94%) in cohort 4, 11 (85%) in cohort 5, and three (60%) in cohort 6.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Tobevibart with elebsiran, with or without pegylated interferon alfa (MARCH Part B): HBsAg loss and functional cure
Daplusiran/tomligisiran (JNJ-3989) with or without bersacapavir (REEF-1 phase 2b): nucleos(t)ide analogue stopping criteria
“The primary endpoint was the proportion of patients meeting predefined nucleos(t)ide analogue-stopping criteria (alanine aminotransferase <3 × upper limit of normal, HBV DNA below the lower limit of quantitation, HBeAg negative, and HBsAg <10 IU/mL) at week 48.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“At week 48, five (5%; 90% CI 2-11) of 91 patients in the JNJ-3989 dual 40 mg group, 15 (16%; 10-24) of 92 in the JNJ-3989 dual 100 mg group, 18 (19%; 13-27) of 94 in the JNJ-3989 dual 200 mg group, eight (9%; 4-15) of 94 in the triple group, and one (2%; 0-10) of 45 in the control group met nucleos(t)ide analogue stopping criteria.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“29 (6%) of 460 patients in the treatment phase and in ten (2%) of 460 patients in the follow-up phase had grade 3 or 4 adverse events.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Although treatment with JNJ-3989 led to a dose-dependent response for meeting nucleos(t)ide analogue-stopping criteria, it rarely led to HBsAg seroclearance.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Daplusiran/tomligisiran (JNJ-3989) with bersacapavir (REEF-2 phase 2b): functional cure after nucleos(t)ide analogue withdrawal
“REEF-2, a phase IIb, double-blind, placebo-controlled, randomized study, enrolled 130 nucleos(t)ide analogue (NA)-suppressed hepatitis B e-antigen (HBeAg)-negative patients with CHB” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“At follow-up Week 24, no patients achieved the primary endpoint of functional cure (off-treatment hepatitis B surface antigen [HBsAg] seroclearance). No patients achieved functional cure at follow-up Week 48.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Off-treatment HBV DNA relapse and alanine aminotransferase increases were less frequent in the active arm, with 7/77 (9.1%) and 11/41 (26.8%) patients in the active and control arms, respectively, restarting NAs during follow-up.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Daplusiran/tomligisiran (JNJ-3989) with pegylated interferon alfa-2a add-on (PENGUIN phase 2): HBsAg response and functional cure
“In total, 48 patients (HBeAg positive, n = 11; HBeAg negative, n = 37) were enrolled; 47 reached follow-up week 48 (FUW48). Of the 48 patients, 31 (64.6%) achieved the primary endpoint; one achieved HBsAg seroclearance (<0.05 IU/ml) at both W24 and FUW48 after stopping NA.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“At W24, 15/48 (31.3%) patients met NA stopping criteria; 11/15 (73.3%) remained off NA by FUW48. One patient achieved functional cure at FUW48.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Most patients had pronounced HBsAg reductions from baseline, no additional benefit from PegIFN-α2a, and did not achieve functional cure.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Imdusiran with pegylated interferon alfa-2a (IM-PROVE I phase 2a): functional cure after nucleos(t)ide analogue discontinuation
Imdusiran (AB-729-001 phase 1a/b): regimens and safety
“These participants received subcutaneous imdusiran as a single dose of 60 mg, 90 mg, or 180 mg (part 2) or as repeat doses of 60 mg or 90 mg every 4, 8, or 12 weeks for up to 48 weeks (part 3).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“All 83 enrolled participants received at least one dose of imdusiran or placebo and were included in the safety analyses. Across all parts, no participants discontinued imdusiran owing to an adverse event and no dose-related trends in reported treatment-emergent adverse events were observed across groups. There were no deaths.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
AHB-137, an unconjugated antisense oligonucleotide (first-in-human phase 1): HBsAg loss and safety
Antisense oligonucleotides compared with siRNAs: HBsAg responses described in the AHB-137 first-in-human report
AHB-137 (phase 1a/1b): structural comparison with bepirovirsen, HBsAg response, and safety
“AHB-137 and bepirovirsen share the same target sequence but differ in pharmacological structure. Bepirovirsen follows a conventional single-gap (5–10–5) gapmer architecture with a continuous central DNA gap flanked by terminal 2′-MOE modifications, whereas AHB-137 adopts a multi-segment structural design in which the gap is divided into shorter segments separated by modified regions, with additional site-specific 2′-modifications.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In Phase 1b, 20 HBeAg-negative, nucleos(t)ide analogue (NA)-suppressed CHB patients with baseline HBsAg 100–1000 IU/mL received MAD AHB-137 (150 or 300 mg) or placebo (8:2), and 2 patients with baseline HBsAg 1000–3000 IU/mL received open-label AHB-137 300 mg.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“No serious adverse events, deaths or discontinuations occurred.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Transaminase elevations were self-limiting; one Grade 3 ALT elevation in the 300 mg CHB cohort coincided with rapid HBsAg loss.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“cross-trial comparisons should be interpreted with caution due to the differences in baseline HBsAg range, sample size, and study design.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
VRON-0200 therapeutic vaccine alone or followed by elebsiran plus tobevibart (phase 1b): HBsAg declines and safety
“This phase 1b, randomised, open-label, multicentre trial included participants with chronic HBV infection aged between 18 and 55 years who had normal liver function, were receiving stable nucleos(t)ide therapy, and had non-detectable HBV DNA for 12 months or more.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“VRON-0200 was well tolerated, with 38 treatment-related adverse events reported (four of grade 2, 34 of grade 1); no treatment-related serious adverse events, discontinuations, or clinical laboratory abnormalities, including liver function test results, were reported.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“In groups 1 and 2, at day 360, 23 (85%) of 27 participants had sustained or continued HBsAg declines (12 [52%] of 23 had reductions of >50%) and four (15%) participants had declines of 1 log10 IU/mL or more from baseline.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“In group 3, the addition of investigational antivirals resulted in rapid and profound HBsAg declines within 7 days (all seven [100%] participants treated with elebsiran plus tobevibart had HBsAg concentrations <2 IU/mL; one [14%] had HBsAg concentrations below the LLOD), regardless of baseline HBsAg concentrations.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Place of product in therapy
Disease description
Definition and etiology
Disease definition: hepatitis B surface antigen persisting for at least 6 months
“The presence of HBsAg establishes the diagnosis of hepatitis B. Chronic vs acute infection is defined by the presence of HBsAg for at least 6 months.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The presence of HBsAg for at least 6 months establishes the chronicity of infection.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Diagnostic criteria for chronic hepatitis B in the AASLD 2018 guidance
Causative agent: hepatitis B virus, a hepatotropic DNA virus of the Hepadnaviridae family
Transmission routes: blood, sexual, perinatal, and percutaneous exposure
Age at infection and risk of chronicity
Genotypes: ten genotypes, with genotypes A, B, and C most prevalent in the United States
“Ten genotypes of HBV have been identified labeled A through J (103, 104). The prevalence of HBV genotypes varies geographically. HBV genotypes A through H have been found in the United States, with genotypes A, B, and C being most prevalent (26). HBV genotypes may play an important role in the progression of HBV-related liver disease as well as response to interferon (IFN) therapy (103, 105).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Studies from Asia found that HBV genotype B is associated with HBeAg seroconversion at an earlier age, more sustained remission after HBeAg seroconversion, less active hepatic necroinflammation, a slower rate of progression to cirrhosis, and a lower rate of HCC development compared with genotype C (103).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Cirrhosis: liver stiffness thresholds used to stage HBV-related fibrosis
Resolution terms: functional cure and partial cure
“The recommended endpoint of novel therapy is functional cure defined as HBsAg loss using a conventional assay for detection of HBsAg (limit of detection 0.05 IU/mL) and HBV DNA below the lower limit of quantification (i.e. < 10 IU/ml) at 24 weeks off-therapy.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Epidemiology
Incidence of Chronic hepatitis B virus infection in adults without cirrhosis
United States, 2023: reported acute hepatitis B cases, estimated infections, and rate
United States, 2023: acute hepatitis B by age, sex, race and ethnicity, and reported risk
United States, 2023: newly reported chronic hepatitis B cases and rate
United States, 2020 model: new chronic infections imported through immigration
“In 2020, it was estimated that 96% (35,000 imported out of 36,400 new chronic cases) of all chronic HBV incident cases (new chronic infections) were among immigrants entering the country, imported chronic cases, with the rest caused by ongoing transmission occurring within the US.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Global, 2024: new hepatitis B virus infections
Prevalence of Chronic hepatitis B virus infection in adults without cirrhosis
United States, NHANES 2013 to 2018: prevalence of chronic infection and share born outside the United States
“Non-US-born residents accounted for 69.1% of the population with chronic HBV infection and were 9.1 times more likely to be living with chronic hepatitis B, compared with US-born persons.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Despite increasing immune protection among young persons vaccinated after birth, the estimated prevalence of persons living with chronic hepatitis B in the USA has remained unchanged at 0.3% since 1999.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
United States, NHANES 2017 to March 2020: prevalence, number infected, and awareness
“During the years 2013–2018, 880,000 persons or 0.3% of the US population aged 6 years and older were estimated to have HBV infection; among these persons, 69.1% were non–US-born, and the prevalence of HBV infection was highest among non-Hispanic (NH) Asian persons.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Among persons aged 6 years and older, 4.0% (95% CI: 3.1%–4.9%) had past or present hepatitis B; and 0.2% (95% CI: 0.1%–0.3%) or an estimated 660,000 (95% CI: 410,000–1,000,000) persons had HBV infection, among whom 49.8% (95% CI: 25.1%–74.6%) were aware of their infection.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“NH-Asian persons accounted for 48.4% (95% CI: 30.6%–66.5%) and non–US-born persons accounted for 73.6% (95% CI: 50.6%–90.0%) of all persons with HBV infection.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“No persons under the age of 20 years were identified with HBV infection; therefore, estimates for persons aged 20 years or older are included in Table 1.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Similarly, the current prevalence estimate is not statistically different from the previous estimate of 880,000.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
United States, 2018: foreign-born persons with chronic infection by region of origin
“Although prevalence of chronic hepatitis B (CHB) in the USA includes 0.42 million (range, 0.28‐0.67) U.S.‐born persons, foreign‐born (FB) persons contribute a substantially larger number to the burden of CHB in the USA.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The weighted average CHB prevalence for all FB in the USA in 2018 was 3.07%. Approximately 59% of FB with CHB in the USA in 2018 emigrated from Asia, 19% from the Americas, and 15% from Africa.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Using FB populations from ACS and country‐specific CHB pooled rates from the mid‐range RE meta‐analyses, we estimate that the number of FB with CHB living in the USA in 2018 was 1.47M persons (95% CI, 1.21‐1.73; Table 1).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Including FB and U.S.‐born persons, the total prevalence of CHB in the USA may be as high as 2.4 million.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
United States, 2019 expert panel: estimated number with chronic infection
United States, 2020 model: number infected, age distribution, and share among immigrants
“In 2020, it is estimated that there were a total of 1.8 million (95% uncertainty interval: 1.3–2.6 million) HBV-positive individuals in the US, corresponding to a prevalence of 0.55% (UI: 0.41–0.77%) in all ages.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The analysis estimated that almost 1.4 million of these infections, or 76% (1.4 million out of 1.8 million total infections) of all estimated infections, were among immigrants.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Of all HBV infections, 82% (1.15 million out of 1.4 million) fell within the ages 30–74.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
United States and Puerto Rico, 2021 model: national and state prevalence
“Utilising this bottom up approach to estimate the prevalence of HBV in the United States, we estimate there are 1.7 million (UI: 795,000–4.1 million) people living with HBV in the United States and Puerto Rico, corresponding to a prevalence of 0.50% (UI: 0.24%–1.23%; Table 1).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Of these cases, 76% are estimated to be among the foreign‐born population (1.3 million, UI: 589,000–3.1 million), with 396,000 (UI: 206,000–1,007,000) cases being among the non‐foreign‐born population (Table 1).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The highest HBV prevalence was found in Hawai‘i, 1.3% (UI: 0.5%–4.0%); California, 0.9% (UI: 0.5%–1.9%); New York, 0.8% (UI: 0.4%–1.7%); Maryland, 0.8% (UI: 0.4%–1.7%); and New Jersey, 0.8% (UI: 0.4%–1.5%; Figure 1).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
United States: range of published estimates cited in the 2023 CDC screening recommendations
“An estimated 580,000 to 2.4 million persons are living with HBV infection in the United States (5,6), two thirds of whom might be unaware of their infection (5).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Chronic HBV infection disproportionately affects persons born outside the United States; non-U.S.–born persons account for 14% of the general population, but account for 69% of the U.S. population living with chronic HBV infection (5–7).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
United States: proportion diagnosed, aware, and treated
“By 2020, we estimate that approximately 334,800 chronic HBV infections were diagnosed in the US, corresponding to a diagnosis coverage of 18% (334,800 diagnosed out of 1.8 million infected) with just under 17% (90,500 treated out of 534,100 eligible) of all eligible individuals on treatment.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“An estimated 1.3 million (95% CI, 0.9–1.7 million) persons in the United States were HBV-infected. 34% (95% CI, 19%–54%) of HBV-infected persons reported awareness and 28% (95% CI, 10%–57%) of aware persons reported ever having HBV treatment.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
United States, commercially insured adults 2003 to 2019: evaluation, treatment eligibility, and treatment
“We included 12,608 eligible patients in the study analysis (mean age 45.7 years, 52.1% male, 54.6% Asian, 18.1% Caucasian, 10.5% African American).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Of those with an adequate evaluation, 11.2% were treatment eligible by AASLD criteria and 13.9% by EASL criteria; 60.4% of AASLD eligible patients and 54.3% of EASL eligible patients received treatment within 12 months from becoming eligible.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Quantitative HBsAg distribution relevant to the 3,000 IU/mL eligibility threshold
Nucleos(t)ide analogue-treated trial participants: HBsAg distribution before peg-interferon add-on
“Mean age was 43 (±11) years, mean SOT HBsAg was 3.03 (±0.94) log10 IU/mL (HBsAg<100 IU/mL: 69 (12%); 100–1000: 163 (28%); ≥1000: 342 (60%)), mean HBV DNA was 1.58 (±0.78) log10 IU/mL, with 517 (89%) patients having HBV DNA<100 IU/mL” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Global, 2024: prevalence, diagnosis, and treatment coverage
Global, 2022 model: prevalence, diagnosis, and treatment of eligible persons
“We developed models for 170 countries which resulted in an estimated global prevalence of HBV infection in 2022 of 3·2% (95% uncertainty interval 2·7-4·0), corresponding to 257·5 million (216·6-316·4) individuals positive for HBsAg. Of these individuals, 36·0 million were diagnosed, and only 6·8 million of the estimated 83·3 million eligible for treatment were on treatment.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Proportion with cirrhosis among adults with chronic infection, United States
No evidence found.
Natural history, survival, and mortality
Phases of chronic infection: AASLD/IDSA 2025 definitions
| Phase | Quoted definition |
|---|---|
| Immune-tolerant | “HBeAg-positive, HBV DNA ≥10,000,000 IU/mL and normal ALT (<25 IU/mL in women, <35 IU/mL in men)” |
| Immune active, HBeAg-positive | “HBeAg-positive and ALT ≥2xULN and HBV DNA ≥20,000 IU/mL” |
| Immune active, HBeAg-negative | “HBeAg-negative and ALT ≥2xULN and HBV DNA ≥2000 IU/mL” |
| Inactive | “HBeAg-negative, HBV DNA <2000 IU/mL and normal ALT” |
| Indeterminate | “HBeAg-positive or negative with HBV DNA level and/or ALT level outside those with immune-tolerant, immune active or inactive CHB” |
Phases of chronic infection: EASL 2025 serologic profile and untreated disease progression
| Marker | HBeAg-positive chronic HBV infection | HBeAg-positive chronic hepatitis B | HBeAg-negative chronic HBV infection | HBeAg-negative chronic hepatitis B |
|---|---|---|---|---|
| HBsAg | “High” | “Intermediate to high” | “Low, usually <1,000 IU/ml” | “Intermediate, usually >1,000 IU/ml” |
| ALT | “Normal” | “Elevated” | “Normal” | “Elevated” |
| Liver disease progression (if untreated) | “None/minimal” | “Moderate to severe” | “None” | “Mild to severe” |
Clinical outcomes in the indeterminate phase
“The annual incidence rate of HCC in patients in the indeterminate phase was 0.32% (95% CI 0.21-0.48%, I2 = 85.7%), and those of cirrhosis and hepatic decompensation were 0.67% (95% CI 0.30-1.49%, I2 = 94.3%) and 0.34% (95% CI 0.17-0.69%, I2 = 51.8%), respectively. The pooled prevalence of moderate-to-severe liver inflammation, significant fibrosis, advanced fibrosis, and cirrhosis was 40.7%, 39.7%, 17.9%, and 7.2%, respectively.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Transition from inactive infection to HBeAg-negative hepatitis
Spontaneous HBsAg loss: approximately 1% per year in pooled cohorts
“The pooled annual rate of HBsAg seroclearance was 1.02% (95% CI, 0.79-1.27). Cumulative incidence rates were 4.03% at 5 years (95% CI, 2.49-5.93), 8.16% at 10 years (95% CI, 5.24-11.72), and 17.99% at 15 years (95% CI, 6.18-23.24).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“A higher proportion of patients who tested negative for HBeAg at baseline had seroclearance (1.33%; 95% CI, 0.76-2.05) than those who tested positive for HBeAg (0.40%; 95% CI, 0.25-0.59) (P < .01).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“In a systematic review and meta-analysis, we found a low rate of HBsAg seroclearance in untreated and treated patients (pooled annual rate, approximately 1%).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Spontaneous HBsAg loss has been reported to occur at the rate of roughly 1% per year, but this rare event does not occur at a linear rate (128, 129). In a study of 1076 patients with CHB in Taiwan, cumulative probabilities of spontaneous HBsAg loss were 8.1% after 10 years and increased to 44.7% after 25 years (129).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Spontaneous HBsAg loss: higher rates in HBeAg-negative infection with low HBsAg, lower rates on nucleos(t)ide analogue therapy
Cirrhosis incidence in untreated chronic infection
Hepatocellular carcinoma incidence by baseline viral load in the REVEAL-HBV cohort
Hepatocellular carcinoma incidence in untreated immune-tolerant and treated immune-active U.S. Veterans
“A total of 591 U-IT and 555 T-IA CHB patients were identified (mean age 56.4-57.5 years, 45%-50% non-Hispanic white, 37%-40% African American, 9%-10% Asian, 25%-29% concurrent diabetes, 35%-39% with FIB-4 > 3.25). Over a median follow up of 6.4 years (IQR 3.0-10.4), incidence of HCC was significantly lower in U-IT patients vs. T-IA patients (0.28 vs. 0.54 per 100 person-years; HR 0.52, 95% CI 0.32-0.83, p = 0.007). However, the risk of cirrhosis or all-cause mortality was similar between both T-IA and U-IT CHB patients.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Mortality in the United States: hepatitis B-related deaths reported in national surveillance
Mortality in the United States: death certificate analysis, 2000 to 2019
“A total of 35 280 decedents with hepatitis B listed as the cause of death were identified, including 17 483 deaths during 2010 to 2019. Decedents were 63.3% US-born, and 25.8% of decedents were Asian or Pacific Islander and 46.5% of decedents were White; 28.4% of decedents were listed as having hepatitis C virus (HCV) or HIV coinfection.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Liver cancer was the predominant UCOD among non-US–born decedents (37.9% of decedents). From 2000 to 2009 compared with 2010 to 2019, the hepatitis B–listed mortality rate significantly decreased nationally (change, −18.97%) and in 14 states; significant increases were observed in West Virginia (change, 83.78%) and Kentucky (change, 69.44%).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Mortality in the United States: premature death and underreporting in the Chronic Hepatitis Cohort Study
“Of 4389 CHB patients followed for a mean of 5.38 years, 492 (11%) CHB patients died after a mean follow-up of 3.00 years.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“CHB patients died at an average age of 59.8 years” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“14 years younger than the general U.S. population” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“and at higher rates for all causes (relative risk [RR] = 1.85, 95% confidence interval [CI], 1.851–1.857) and liver-related causes (RR = 15.91, 95% CI, 15.81–16.01). Only 19% of CHB decedents and 40% of those dying of liver disease had hepatitis B reported on their death certificates.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Projected U.S. liver-related deaths, 2019 to 2030
“The annual incidence of decompensated cirrhosis is projected to increase by 20% from 2019 to 2030 from 1700 (UI: 1100–2700) to 2100 (UI: 1300–3300) cases, hepatocellular carcinoma (HCC) annual incidence is forecasted to increase by 31% from 6500 (4500–9600) 8500 (UI: 5900–12,500) cases, and liver related deaths are expected to increase by 25% from 7900 (UI: 5500–11,600) to 9900 (UI: 6600–14,900) deaths annually.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Global mortality: approximately 1.1 million HBV-related deaths in 2024
Pathophysiology
Immune-mediated liver injury by a non-cytopathic virus
“As HBV is not directly cytopathic, host responses to the virus-infected hepatocytes are believed to mediate liver cell injury and, with long-term chronic liver inflammation and ineffective immune-mediated viral clearance, contribute to the development of cirrhosis and liver cancer (92), (93).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Covalently closed circular DNA: the nuclear transcriptional template and long-lived reservoir
“The host DNA repair machinery9 converts the incoming DNA to covalently closed circular DNA (cccDNA) molecules that are packaged into chromatin-like minichromosomes by histone and non-histone proteins,10,11 whereupon it acts as the HBV transcriptional template and long-lived reservoir in the hepatocyte nucleus.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“A major hurdle to HBV “cure” is the presence of cccDNA in the hepatocyte nucleus in a non-integrated form or episome. cccDNA serves as the template for transcription of all viral RNAs including pregenomic RNA and thus plays a key role in the viral lifecycle.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The half-life of cccDNA is long thus explaining why it is difficult to cure HBV infection and why HBV can reactivate either spontaneously or following immune suppression, many years after clearance of HBsAg.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Current therapies (pegylated interferon alfa [pegIFNa] and nucleos(t)ide analogues [NAs]) are not curative due to persistence of covalently closed circular DNA (cccDNA), a stable, non-integrated form of viral DNA located in the hepatocyte nucleus, as well as HBV DNA that is directly integrated into the host genome.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Integrated HBV DNA: a source of HBsAg independent of viral replication
“Integrated HBV DNA is derived from linear genomic DNA present in viral particles or produced from aberrantly processed relaxed circular genomic DNA following an infection, and can drive expression of hepatitis B surface antigen (HBsAg) and HBx. DNA integration events accumulate over the course of viral infection, ranging from a few percent during early phases to nearly 100 percent of infected cells after prolonged chronic infections.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Because integrated DNA is responsible for persistence of HBsAg in the absence of viral replication it impacts established criteria for the resolution of HBV infection, which rely on HBsAg as a diagnostic marker.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Hindering the goal of functional cure as a treatment endpoint is the fact that HBsAg in serum originates from two sources, cccDNA and integrated HBV DNA. Although novel treatments in development may potentially eliminate or silence cccDNA, they may not abolish ongoing RNA transcription from integrated viral genomes, and HBsAg would remain detectable in serum.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Although qHBsAg reflects covalently closed circular DNA and intrahepatic DNA levels, it also measures HBsAg that arises from integrated DNA, thereby reducing its specificity as a biomarker for viral replication.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Limited effect of nucleos(t)ide analogues on cccDNA and HBsAg production
HBsAg and T-cell exhaustion
“HBV-specific T cells necessary for HBV control (and may also play a role in hepatic inflammation) are dysfunctional and may be depleted or deleted in chronic HBV.53,54 Their exhausted phenotype has been attributed to persistent antigen exposure and increased expression of T cell inhibitory responses,3,52,55 providing the basis for the focus on reducing HBsAg production.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Chronic exposure to high levels of HBV antigens, especially HBsAg, results in host immune dysfunction. Multiple immune signaling pathways are influenced by HBV antigens, which ultimately result in virus-specific and global T-cell dysfunction [43, 44].” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“For example, we now trust that HBV integration into the host genome often serves as a relevant source of hepatitis B surface antigen (HBsAg) expression during chronic infection, possibly triggering dysfunctional T cell responses and favouring detrimental immunopathology.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“More recent evidence suggests that HBsAg expression from integrated DNA might contribute to HBV pathogenesis by attenuating the immune response.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“During acute infection, cccDNA can be silenced and/or degraded through immune mechanisms, however in chronic infection the immune responses are dysfunctional and not easily restored by current treatments.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Integration and hepatocarcinogenesis
“HBV DNA integration events have primarily been investigated in the context of hepatocellular carcinoma development as they can activate known oncogenes and other growth promoting genes, cause chromosomal instability and, presumably, induce epigenetic alterations, promoting tumour growth.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Rationale for HBsAg loss as the treatment goal
“Of all these surrogate endpoints, HBsAg loss is considered to be the most relevant because HBsAg seroclearance is associated with sustained off-treatment improvement in clinical outcomes.(1, 2) Additionally, HBsAg loss has been shown to have an additional clinical benefit (lower rates of HCC and hepatic decompensation) over HBV DNA suppression alone, particularly in patients with cirrhosis.(3, 4) Moreover, HBsAg seroclearance is easy to measure with standardized and widely available assays.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Nonetheless, a sustained seroclearance of HBsAg, (i.e., rendering HBsAg to levels below the currently accepted detection enzyme immune assays, <0.05 IU/ml), plausibly implies profound suppression of replication of HBV, and suggests reduced overall expression from cccDNA and integrated viral genomes.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Diagnosis
Universal adult screening with the triple panel: CDC 2023 recommendations
“New recommendations include hepatitis B screening using three laboratory tests at least once during a lifetime for adults aged ≥18 years.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Triple panel screening: Using the triple panel (HBsAg, anti-HBs, and total anti-HBc) is recommended for initial screening because it can help identify persons who have an active HBV infection and could be linked to care, have resolved infection and might be susceptible to reactivation (e.g., immunosuppressed persons), are susceptible and need vaccination, or are vaccinated.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Universal screening: Universal screening of adults is cost-effective compared with risk-based screening and averts liver disease and death (56).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Risk-based screening: USPSTF 2020 recommendation
“Up to 60% of HBV-infected persons are unaware of their infection, and many remain asymptomatic until onset of cirrhosis or end-stage liver disease.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“The USPSTF recommends screening for HBV infection in adolescents and adults at increased risk for infection. (B recommendation).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Screening markers: EASL 2025 recommendation
Initial virologic evaluation of HBsAg-positive persons: HBeAg and HBV DNA
“After identifying a person with HBV infection, testing for HBeAg, anti-HBe, and HBV DNA can provide information on the level of viral replication and infectivity and help guide clinical management.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Quantitative HBsAg: assays, thresholds, and role in phase classification and treatment endpoints
“The desire to assess covalently closed circular DNA (cccDNA) inside hepatocytes led to development of reproducible, automated, and standardized (IU/mL) assays (Architect QT assay [Abbott], Elecsys HBsAg III Quant [Roche], Liaison XL [DiaSorin]) to quantify hepatitis B surface antigen (109).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Although qHBsAg reflects covalently closed circular DNA and intrahepatic DNA levels, it also measures HBsAg that arises from integrated DNA, thereby reducing its specificity as a biomarker for viral replication.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In HBeAg-negative patients, low qHBsAg (<1,000 IU/mL) and low HBV DNA (≤2,000 IU/mL) suggest inactive CHB.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Assessment of fibrosis and cirrhosis: noninvasive methods and liver stiffness thresholds
Bepirovirsen patient selection: quantitative HBsAg testing and the FDA-authorized companion diagnostic
Clinical presentation - signs and symptoms
Asymptomatic chronic infection: no symptoms until advanced liver disease in most persons
“Some reasons for these low rates of surveillance, diagnosis, and treatment include the asymptomatic nature of chronic hepatitis B until the very late stages, a lack of curative therapy with a finite treatment duration, a complex natural history, and a lack of knowledge about the disease by both care providers and patients.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Once treatment is initiated, adherence to treatment is often poor due to the asymptomatic nature of CHB during the pre-end-stage liver disease period.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Acute hepatitis symptoms: jaundice, fatigue, abdominal pain, and dark urine
“Abdominal pain, nausea, and/or vomiting” (opens the source at this quote in a new tab)
“Dark urine or clay-colored stools” (opens the source at this quote in a new tab)
“Fatigue” (opens the source at this quote in a new tab)
“Fever” (opens the source at this quote in a new tab)
“Jaundice” (opens the source at this quote in a new tab)
“Joint pain” (opens the source at this quote in a new tab)
“Loss of appetite” (opens the source at this quote in a new tab)
Hepatic flares: aminotransferase elevations during chronic infection and after antiviral withdrawal
“Hepatitis flare: ALT increase ≥3 times baseline and >100 U/L” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Hepatic decompensation: variceal bleeding, ascites, hepatic encephalopathy, and hepatorenal syndrome
“HBV-associated liver failure is reasonably defined as 1 of the following: (i) impaired synthetic function (total bilirubin >3 mg/dL or international normalized ratio >1.5), (ii) ascites, (iii) encephalopathy, or (iv) death following HBV-associated liver failure due to HBV reactivation.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Extrahepatic manifestations: vasculitis, glomerulopathy, arthritis, and lymphoma
Long-term morbidity
Chronic liver disease in 15% to 25% of persons with chronic infection
Cirrhosis, decompensation, and survival
Hepatocellular carcinoma: viral load as a risk factor
Residual cirrhosis and hepatocellular carcinoma risk on antiviral therapy in non-cirrhotic U.S. Veterans
“Among 2,496 patients with non-cirrhotic CHB (39.1% African American, 38.4% non-Hispanic White, 18.8% Asian, mean age 58.0 ± 13.4 years), the overall incidences of cirrhosis and HCC were 3.99 per 100 person-years (95% CI 3.66-4.35) and 0.43 per 100 person-years (95% CI 0.33-0.54), respectively. The highest incidences of cirrhosis and HCC were observed in non-Hispanic White patients (5.74 and 0.52 per 100 person-years, respectively), which were significantly higher than in Asian patients (1.93 and 0.17 per 100 person-years, respectively, p <0.0001).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Residual hepatocellular carcinoma risk beyond 10 years of entecavir or tenofovir
“Of 1,644 patients, 903 were followed beyond year 10 (mean:14 ± 2 years). The 10- and 15-year cumulative incidences of HCC were 10.9% and 13.2%, respectively. The HCC IR was 1.25 before year 10 and 0.55/100 PYs after year 10 (p <0.001), with similar findings after inverse probability weighting.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Despite >10 years of NA therapy, patients with CHB remain at risk of HCC, although the incidence rate declines significantly. HCC remains the main determinant of mortality.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Residual hepatocellular carcinoma risk after HBsAg loss
“Patients who experienced HBsAg seroclearance had significantly lower HCC incidence than HBsAg‐positive (RR = 0.41, p < .001). The pooled HCC incidence after HBsAg seroclearance was 1.88%; this rate was reduced to 0.76% among patients without baseline cirrhosis.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The results showed that HBsAg seroclearance was durable, with a pooled recurrence rate of 6.19% (95% CI: 4.10%–8.68%).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Although progression of liver disease to cirrhosis or hepatic decompensation generally stops when patients lose HBsAg unless other causes of liver injury are present (eg, heavy alcohol consumption or nonalcoholic fatty liver), the risk of HCC persists, particularly if HBsAg loss occurred in patients older than 50 years or in those with cirrhosis or coinfection with HCV or hepatitis D virus (HDV) (128, 130–132).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Liver transplantation and end-stage outcomes among U.S. decedents with chronic hepatitis B
“Compared to survivors, decedents were older, more likely to be White (40.6%), African-American (27.1%), or male (74.2%); and more likely to have had cirrhosis (59.8%), diabetes (27.2%), alcohol abuse (17.7%), hepatocellular carcinoma (17.5%), or a liver transplant (5.7%); whereas survivors were more likely to be Asian (48.8%; all P < .001).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The IR of death or LT was lower before vs. after year 10 (1.50 vs. 1.95/100 PYs, p = 0.069), whereas the IR was similar for liver-related death/LT between the two periods (0.74 vs. 0.70/100 PYs, p = 0.840).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Projected U.S. decompensated cirrhosis and hepatocellular carcinoma, 2019 to 2030
Hepatitis D coinfection: prevalence and hepatocellular carcinoma risk in the United States
“A total of 6719 patients were diagnosed with HBV/HDV among 144,975 with HBV and 12 months of continuous data, for a prevalence of 4.6%. At diagnosis, 31.7% of patients with HBV/HDV had advanced liver complications, including compensated cirrhosis (16.3%) and decompensated cirrhosis (10.4%).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Extrahepatic disease: immune-complex manifestations and extrahepatic malignancies
Burden of Chronic hepatitis B virus infection in adults without cirrhosis
Humanistic burden and health-related quality of life
Utility values by disease stage: global meta-analysis of 19 studies with 10,311 patients
“Twenty-two articles from 19 studies, comprising 10,311 patients, were included. Of these studies, 74% were performed in the Western Pacific Region, and 47% used the EuroQoL-5D-3L instrument. HRQOL was found to decrease with advancing stages of HBV-related disease.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Meta-regression showed the following predicted mean utility scores for the different stages of chronic HBV infection: non-cirrhotic, 0.842; compensated cirrhosis, 0.820 ( p = 0.474 compared with non-cirrhotic); decompensated cirrhosis, 0.722 ( p = 0.001); and hepatocellular carcinoma, 0.749 ( p = 0.008).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Chronic HBV infection impairs the HRQOL of patients, even when there is no evidence of cirrhosis. HRQOL is particularly impaired in the advanced stages of decompensated cirrhosis and hepatocellular carcinoma.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Utility values by disease stage in the United States, Europe, Canada, Australia, and New Zealand: meta-analysis of chronic hepatitis B studies
| Health state (chronic hepatitis B, any instrument) | Mean utility | 95% CI |
|---|---|---|
| Noncirrhotic (F0-F3) | “0.84” | “0.78-0.90” |
| Compensated cirrhosis (F4) | “0.77” | “0.65-0.89” |
| Decompensated cirrhosis | “0.35” | “0.31-0.40” |
| Hepatocellular carcinoma | “0.49” | “0.23-0.75” |
| Post liver transplantation, year 1 | “0.57” | “0.51-0.62” |
| Post liver transplantation, year 2 and later | “0.67” | “0.62-0.72” |
Standard gamble utilities from infected and uninfected respondents in six jurisdictions, including the United States
“Standard gamble utilities were elicited from hepatitis patients and uninfected respondents using an interviewer-administered survey in the United States, Canada, United Kingdom, Spain, Hong Kong, and mainland China.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“The sample included 534 CHB-infected patients and 600 uninfected respondents. CHB and compensated cirrhosis had a moderate impact on HRQOL with utilities ranging from 0.68 to 0.80. Decompensated cirrhosis and hepatocellular carcinoma had a stronger impact with utilities ranging from 0.35 to 0.41.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Significant variation was observed between countries, with both types of respondents in mainland China and Hong Kong reporting systematically lower utilities.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Patient-reported outcomes and viral suppression in 242 phase 2 trial participants without advanced fibrosis or cirrhosis
“We collected and analyzed PRO data from 242 patients with chronic HBV infection (without advanced fibrosis or cirrhosis) enrolled in 2 international phase 2 blinded controlled clinical trials from 2015 through 2017.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“At baseline, patients with viral suppression (HBV DNA level, <20 IU/mL) had higher PRO scores (by up to +10.6% of a PRO range size).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“In multivariate analysis, a reduction in viral load was independently associated with increases in PROs (β values up to 1.6% per log10 IU/mL decrease; P < .05).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Fatigue, patient-reported outcomes, and work productivity in 1561 registry participants with chronic hepatitis B from 14 countries
“Among 2888 patients from 14 countries, 1561 had CHB (mean age 47 ± 13 years; 60% male; 13% advanced fibrosis; 13% depression; 17% fatigue)” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“CHB-fatigue was associated with younger age, female, obesity, anxiety, depression (all p < 0.01) and worse PRO scores: CLDQ (scale 1-7): 4.1 ± 0.9 vs. 5.8 ± 0.9; FACIT score (range 0-108): 67.6 ± 14.5 vs. 87.7 ± 13.7; work productivity impairment (range 0-1): 0.33 ± 0.29 vs. 0.11 ± 0.22 (all p < 0.0001).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Depressive and anxiety symptoms: meta-analysis of 31 studies
“We identified a high prevalence of depressive symptoms (Proportion=19%, 95% CI: 11-31) and anxiety (Proportion=30%, 95% CI: 18-45) among individuals with hepatitis B. There was also a significantly increased risk of depressive symptoms (RR=1.45, 95% CI: 1.00-2.09, P=0.049) and anxiety (RR=1.40, 95% CI: 1.11-1.78) in individuals with hepatitis B compared to controls.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Subgroup analyses indicated that older age and chronic hepatitis B infection were associated with a higher prevalence of anxiety and depressive symptoms.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Qualitative health-related quality of life interviews with 19 adults in the United States
“A sample of 19 individuals living with chronic HBV were included within this study.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The psychological impact of chronic HBV on study participants’ HRQL overall was considerable and contributed to depression, anxiety, homelessness, drug use, and incarceration.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Our analysis supports the hypothesis that HBV impacts HRQL and often negatively affects emotional health.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Stigma: systematic review of 23 studies
“A total of 23 (17 quantitative and 6 qualitative) articles examined HBV-related stigma.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Some people also perceived structural/institutional stigma, with up to 20% believing that they may be denied healthcare and up to 30% stating they may experience workplace discrimination due to HBV.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“HBV-related stigma is common, particularly in some countries in Southeast Asia and the Western Pacific region and among Asian immigrant communities, but is poorly characterized in non-Asian populations.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Discrimination: global registry of 569 respondents from 65 countries
“A total of 569 individuals responded to the survey between May 2021 and December 2023.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Of these, 461 individuals shared details about their experiences of discrimination with most relating to restrictions on access to work visas, followed by in-country hepatitis B-related employment restrictions, educational-based discrimination, discrimination within the community and health facilities, and the emotional impact of hepatitis B discrimination.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Economic burden and healthcare resource utilization
Annual all-cause healthcare costs by disease severity: U.S. Commercial, Medicare, and Medicaid claims, 2004 to 2015
Inpatient cost share and inpatient use by disease severity in the same claims study
Inpatient costs of hospitalizations with chronic hepatitis B: National Inpatient Sample, 2016 to 2019
“The 2016–2019 National Inpatient Sample was used to select individuals diagnosed with CHB.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“From 2016 to 2019, the total costs of hospitalizations in CHB patients were $603.82, $737.92, $758.29, and $809.01 million dollars from 2016 to 2019, respectively.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“We did not observe significant cost trends in the composite CHB population or in the cirrhosis and non-cirrhosis cohorts.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Medicare beneficiaries with chronic hepatitis B: outcomes and charges, 2005 to 2014
“Study cohort included 18,603 Medicare recipients with CH-B. Between 2005 and 2014, number of Medicare beneficiaries with CH-B increased by 4.4% annually.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Furthermore, 7.4% of CH-B Medicare cohort experienced decompensated cirrhosis, 2.9% hepatocellular carcinoma (HCC) and 11.9% 1-year mortality.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Annual total inpatient charges increased from $66,610 to $94,221 while these charges for outpatient increased from $9257 to $47,863.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Veterans Health Administration: total costs and nucleos(t)ide analogue persistence
“Among patients treated with NAs ( N = 2368), 1428 (60%) were CHB mono-infected and 748 (32%) were HIV co-infected. Total costs per patient per year (PPPY) were $39,240, $29,957, and $55,220 PPPY for NA-treated, mono-infected, and HIV co-infected patients, respectively.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Persistence among the inception cohort was 29% for first year and 14% for first 2 years.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Medicaid spending on nucleos(t)ide analogues, 2012 to 2021
“Over the study period, 1.9 billion USD was spent on NA, with spending peaking in 2016 at $289 million US, which has subsequently decreased. Lower expenditures since 2016 have been associated with increased use of generics. The use of generic tenofovir or entecavir led to savings of $669 million US over the study period.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Average wholesale prices of nucleos(t)ide analogues: Vermont prescriber price disclosure, January 2024
“The prices listed below are Average Wholesale Prices” (opens the source at this quote in a new tab)
“Wholesale Acquisition Cost (WAC) plus 20%” (opens the source at this quote in a new tab)
“Source: First Databank, 01/28/2024.” (opens the source at this quote in a new tab)
| Product | Labeler as listed | Package | Package price (AWP) | Unit price (AWP) |
|---|---|---|---|---|
| Tenofovir alafenamide 25 mg tablet (Vemlidy) | “Gilead Sciences” | “30 EA” | “$1,729.91” | “$57.66” |
| Entecavir 0.5 mg tablet (Baraclude) | “Bms Primarycare” | “30 EA” | “$1,646.98” | “$54.90” |
| Entecavir 0.5 mg tablet, generic, lowest listed | “Epic Pharma Llc” | “30 EA” | “$9.60” | “$0.32” |
| Entecavir 0.5 mg tablet, generic | “Camber Pharmace” | “30 EA” | “$48.00” | “$1.60” |
| Entecavir 0.5 mg tablet, generic, highest listed | “Marlex Pharm.” | “30 EA” | “$864.00” | “$28.80” |
| Adefovir dipivoxil 10 mg tablet, generic | “Apotex Corp” | “30 EA” | “$1,074.00” | “$35.80” |
Annual antiviral drug and monitoring cost inputs in a U.S. cost-effectiveness model (2021 U.S. dollars)
“Although the lowest price for antiviral drugs is generic tenofovir disoproxil fumarate at $325 per year” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“we used an annual antiviral drug cost of $502 with the assumption that 60% of the patients will be dispensed generic tenofovir disoproxil fumarate and 40% generic entecavir.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“we assumed that they will receive initial baseline tests (hepatitis B e antigen, complete blood count, complete metabolic panel, HBV DNA), and twice yearly clinic visits with alanine aminotransferase blood tests and yearly HBV DNA viral load tests, and that eligible patients (50%) would receive additional hepatocellular carcinoma surveillance consisting of liver ultrasound and α-fetoprotein every 6 months” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Annual medical management costs by disease stage used in a U.S. hepatitis D testing cost-effectiveness model (2024 U.S. dollars)
| Health state | Base value | Range |
|---|---|---|
| Cirrhosis | “$5964”View highlighted excerpt for this quote | “$202–$7096”View highlighted excerpt for this quote |
| Decompensated cirrhosis | “$15 795”View highlighted excerpt for this quote | “$4901–$37 081”View highlighted excerpt for this quote |
| Liver transplantation, first year | “$215 162”View highlighted excerpt for this quote | “$167 163–$250 746”View highlighted excerpt for this quote |
| Liver transplantation, second year | “$26 860”View highlighted excerpt for this quote | “$23 958–$35 937”View highlighted excerpt for this quote |
Projected U.S. direct medical costs, diagnosed population, and treated population: PRoGReSs model, 2020 to 2050
Economic impact of Chronic hepatitis B virus infection in adults without cirrhosis on families
Caregiver or household cost studies in U.S. adults with chronic hepatitis B
No evidence found.
Patient out-of-pocket and productivity costs of liver cancer surveillance: U.S. insured adults without cirrhosis
“Of 6831 patients (1122 on antiviral treatment, 5709 untreated), only 39.3% and 51.3% had received any abdominal imaging after 6 and 12 months, respectively, and patients were up to date with HCC surveillance guidelines for only 28% of the follow‐up time.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Mean total and patient‐paid daily surveillance‐related costs ranged from $99 (ultrasound) to $334 (magnetic resonance imaging), and mean annual patient costs due to lost productivity for surveillance‐related outpatient visits ranged from $93 (using the federal minimum wage) to $321 (using the Bureau of Labor Statistics wage).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Total and patient‐paid mean daily costs of outpatient surveillance were highest for MRI only ($1717 and $334, respectively) and lowest for ultrasound only ($415 and $99, respectively)” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Economic impact of diagnostic testing
Quantitative HBsAg testing required for patient selection
Minimum on-treatment laboratory monitoring required by the prescribing information
Availability of quantitative HBsAg tests at approval
Medicare reimbursement for hepatitis B laboratory tests used in a U.S. hepatitis D testing cost-effectiveness model (2024 U.S. dollars)
| Test or service | Unit cost and frequency over 48 weeks of treatment | Cost basis |
|---|---|---|
| HBV DNA test | “$59 × 4”View highlighted excerpt for this quote | “Medicare reimbursement”View highlighted excerpt for this quote |
| HBsAg test | “$10.33 × 4”View highlighted excerpt for this quote | “Medicare reimbursement”View highlighted excerpt for this quote |
| LFT and CBC with platelet count | “$86.74 × 4”View highlighted excerpt for this quote | “Medicare reimbursement”View highlighted excerpt for this quote |
| Comprehensive metabolic panel | “$10.56 × 4”View highlighted excerpt for this quote | “Medicare reimbursement”View highlighted excerpt for this quote |
| Clinic visits | “$74 × 8”View highlighted excerpt for this quote | “Medicare reimbursement”View highlighted excerpt for this quote |
Medicare reimbursement for hepatitis B serology tests used in a U.S. testing cost-effectiveness model
Cost-effectiveness of one-time universal HBsAg screening of U.S. adults
“At an estimated 0.24% prevalence of undiagnosed CHB, universal hepatitis B surface antigen (HBsAg) screening in adults aged 18-69 years is cost-saving compared with current practice if antiviral treatment drug costs remain below $894/year.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Compared with current practice, universal screening would avert an additional 7.4 cases of compensated cirrhosis, 3.3 cases of decompensated cirrhosis, 5.5 cases of hepatocellular carcinoma, 1.9 liver transplants, and 10.3 hepatitis B virus-related deaths at a saving of $263 000/100 000 adults screened.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Testing costs were based on Medicare reimbursement rates.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Cost-effectiveness of one-time HBV testing at vaccination in adults seeking care for sexually transmitted infection
“Compared with current recommendations, the addition of 1-time HBV testing is cost-saving and would prevent an additional 138 cases of cirrhosis, 47 cases of decompensated cirrhosis, 90 cases of hepatocellular carcinoma, 33 liver transplants, and 163 HBV-related deaths, and gain 2185 QALYs, per 100,000 adults screened.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Screening with the 3-test panel would save $41.6 to $42.7 million per 100,000 adults tested compared with $41.5 to $42.5 million for the 2-test panel and $40.2 to $40.3 million for HBsAg alone.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Reimbursement specific to quantitative HBsAg assays and to fibrosis assessment for excluding cirrhosis
No evidence found.
Approaches to treatment
Current treatment options and standard of care
Nucleos(t)ide analogues
Preferred agents and selection criteria: AASLD/IDSA 2025 guideline
Treatment goals and indications: AASLD/IDSA 2025 guideline
Preferred initial therapy: AASLD 2018 guidance
“The AASLD recommends antiviral therapy for adults with immune-active CHB (HBeAg negative or HBeAg positive) to decrease the risk of liver-related complications” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The AASLD recommends peg-IFN, entecavir, or tenofovir (TDF) as preferred initial therapy for adults with immune-active CHB” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“TAF is also a preferred initial therapy for adults with immune-active CHB.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Consider TAF or entecavir in patients with or at risk for renal dysfunction or bone disease.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“However, in recommending peg-IFN, tenofovir, and entecavir as preferred therapies, the most important factor considered was the lack resistance with long-term use.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
First-line nucleos(t)ide analogue therapy: EASL 2025 guideline
Preferred regimens: WHO 2024 guideline
Efficacy in HBeAg-negative immune-active chronic hepatitis B: pivotal trial summary
| Outcome (HBeAg-negative, treatment-naive adults) | Peginterferon | Entecavir | Tenofovir disoproxil fumarate | Tenofovir alafenamide |
|---|---|---|---|---|
| % HBV DNA suppression | “19 (<80 IU/mL)”View highlighted excerpt for this quote | “90–91 (<50–60 IU/mL)”View highlighted excerpt for this quote | “93 (<60 U/mL)”View highlighted excerpt for this quote | “90 (<29 IU/mL)”View highlighted excerpt for this quote |
| % Normalization ALT | “59”View highlighted excerpt for this quote | “78–88”View highlighted excerpt for this quote | “76”View highlighted excerpt for this quote | “81”View highlighted excerpt for this quote |
| % HBsAg loss | “4”View highlighted excerpt for this quote | “0–1”View highlighted excerpt for this quote | “0”View highlighted excerpt for this quote | “<1”View highlighted excerpt for this quote |
HBsAg seroclearance rate in untreated and treated cohorts: meta-analysis
“We analyzed 34 published studies (with 42,588 patients, 303,754 person-years of follow-up, and 3194 HBsAg seroclearance events), including additional and updated aggregated data from 19 studies. The pooled annual rate of HBsAg seroclearance was 1.02% (95% CI, 0.79-1.27). Cumulative incidence rates were 4.03% at 5 years (95% CI, 2.49-5.93), 8.16% at 10 years (95% CI, 5.24-11.72), and 17.99% at 15 years (95% CI, 6.18-23.24).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“HBsAg seroclearance was not associated with HBV genotype or treatment history.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Patients with chronic HBV infection should therefore be counseled on the need for lifelong treatment, and curative therapies are needed.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Long-term tenofovir alafenamide: 8-year suppression and HBsAg loss
“By year 8, 2%–3% of patients had achieved HBsAg loss with or without seroconversion (Table 2; Tables S1 and S2).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Conversely, rates of HBsAg loss and seroconversion were low at 2%–3%, and quantitative HBsAg titres declined minimally over 8 years.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“No patients developed resistance to TAF.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Long-term outcomes on entecavir or tenofovir: PAGE-B cohort beyond 10 years
“The long-term PAGE-B cohort included 1,644 Caucasian patients with CHB treated with entecavir or tenofovir.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“The 10- and 15-year cumulative incidences of HBsAg loss on NA(s) were 8.3% and 14.3%, respectively; the IR of HBsAg loss increased from 0.94 before year 10 to 1.42/100 PYs after year 10 (p = 0.025).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“NA therapy was discontinued in 125 (7.6%) patients who remained HBsAg positive.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Clinical benefits of long-term viral suppression: EASL 2025 guideline
Pegylated interferon alfa
Current role: AASLD/IDSA 2025 guideline
Recommendations on administration, stopping rules, and add-on therapy: EASL 2025 guideline
Patient selection and duration: AASLD 2018 guidance
“Comorbidities: peg-IFN is contraindicated in persons with autoimmune disease, uncontrolled psychiatric disease, cytopenia, severe cardiac disease, uncontrolled seizures, and decompensated cirrhosis.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“For patients treated with peg-IFN, 48 weeks’ duration is used in most studies and is preferred. This treatment duration yields HBeAg seroconversion rates of 20% to 31% and sustained off-treatment HBV DNA suppression of <2,000 IU/mL in 65% of persons who achieve HBeAg to anti-HBe seroconversion. The combination of peg-IFN and NAs has not yielded higher rates of off-treatment serological or virological responses and is not recommended.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Differences between peginterferon and nucleos(t)ide analogue therapy
| Feature | ETV, tenofovir (TDF, TAF) | PEG-IFNα |
|---|---|---|
| Strategy | “Preventing disease progression through persistent HBV suppression” | “Induction of an off-treatment response through finite treatment” |
| Administration | “Oral, once daily” | “Subcutaneous, once weekly” |
| Treatment duration | “Long-term” | “Finite (48 weeks)” |
| Side effects | “Very low” | “Moderate to high” |
| Contraindications | “Very few (e.g. ETV in pregnancy)” | “Numerous” |
| HBsAg loss | “Very low” | “Low, higher compared to NAs” |
| Risk of viral resistance | “Very low” | “Absent” |
HBsAg loss with peginterferon monotherapy: HBeAg-negative pivotal trial
“We compared the efficacy and safety of peginterferon alfa-2a (180 microg once weekly) plus placebo, peginterferon alfa-2a plus lamivudine (100 mg daily), and lamivudine alone in 177, 179, and 181 patients with HBeAg-negative chronic hepatitis B, respectively. Patients were treated for 48 weeks and followed for an additional 24 weeks.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Loss of hepatitis B surface antigen occurred in 12 patients in the peginterferon groups, as compared with 0 patients in the group given lamivudine alone.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
HBsAg seroconversion with peginterferon: HBeAg-positive pivotal trial
Durable HBsAg loss after finite peginterferon: 2022 AASLD-EASL endpoints conference
“Historically, a finite course of pegIFNa monotherapy (48 weeks) can result in durable off-treatment HBsAg loss in up to approximately 11% of patients (mostly HBeAg positive) although these results vary by genotype and baseline serum ALT.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Peginterferon added to or switched from nucleos(t)ide analogues: EASL 2025 evidence review
Peginterferon add-on to nucleos(t)ide analogues: individual participant data meta-analysis
“581 patients were included. At the start of peg-IFN therapy (SOT), 44% were hepatitis B envelope antigen (HBeAg) positive, mean HBsAg level was 3.03 log10 IU/mL (HBsAg<100: 12%; 100–1000: 28%; ≥1000: 60%), and planned duration of peg-IFN was 48 weeks in 496 patients (85%).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“At EOF, 50 (8.6%) patients achieved HBsAg loss (HBsAg<100/100–1000/≥1000: 37.7/9.8/2.3%, p<0.001) Findings were consistent across ethnicities (Caucasian: 30.0/8.7/3.6%; Asian: 39.3/9.2/2.2%).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Peg-IFN add-on results in HBsAg loss in 18% of patients with SOT HBsAg<1000 IU/mL, and in 38% if SOT HBsAg<100 IU/mL.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“57 (10%) patients discontinued peg-IFN prior to the planned end-date, and these rates varied between 0% and 21% in the included studies (online supplemental table S1).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Nucleos(t)ide analogue withdrawal
Recommendation against withdrawal before HBsAg loss: AASLD/IDSA 2025 guideline
Criteria, monitoring, and restart rules for persons who wish to stop: AASLD/IDSA 2025 guideline
Evidence summary behind the AASLD/IDSA 2025 recommendation
HBsAg loss and relapse after discontinuation: technical review supporting the AASLD/IDSA 2025 guideline
Recommendations on stopping nucleos(t)ide analogues: EASL 2025 guideline
HBsAg loss, relapse, and severe events after stopping: EASL 2025 evidence review
Off-therapy outcomes in a multinational cohort: RETRACT-B
Discontinuation considered only exceptionally: WHO 2024 guideline
Stopping after HBsAg loss: AASLD 2018 guidance
“Treatment discontinuation in persons with cirrhosis is not recommended owing to the potential for decompensation and death, although data are limited.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Treatment discontinuation may be considered in persons who have demonstrated loss of HBsAg. However, there is currently insufficient evidence to definitively guide treatment decisions for such persons.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Nucleos(t)ide analogue cessation after bepirovirsen: label criteria
Limitations of current therapies
Summary: limitations of current therapies
Guideline-preferred nucleos(t)ide analogues suppress HBV DNA but are given long term: the AASLD 2018 guidance suggests “indefinite antiviral therapy for adults with HBeAg-negative, immune-active CHB”, and the WHO 2024 guideline states that “Antiviral therapy is lifelong.” A meta-analysis of 34 studies reported a pooled annual HBsAg seroclearance rate of 1.02%, and 8-year tenofovir alafenamide data show HBsAg loss in 2% to 3% of participants. In the PAGE-B cohort of 1,644 Caucasian patients treated with entecavir or tenofovir, the 10- and 15-year cumulative incidences of HCC were 10.9% and 13.2%. In a cohort of 6696 patients receiving long-term nucleos(t)ide analogue therapy, the discontinuation probability was 29.4% at 12 months and 55.6% at 5 years. Peginterferon is a finite alternative with higher HBsAg loss than nucleos(t)ide analogues, but the AASLD/IDSA guideline states that it “is rarely used, given its limitations of applicability, safety and tolerability”.
Indefinite duration of nucleos(t)ide analogue therapy
“The AASLD suggests indefinite antiviral therapy for adults with HBeAg-negative, immune-active CHB unless there is a compelling rationale for treatment discontinuation” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“A decision to discontinue therapy for HBeAg-negative adults without cirrhosis requires careful consideration of risks and benefits for health outcomes, including the following: (i) risk for virological relapse, hepatic decompensation, liver cancer, and death; (ii) burden of continued antiviral therapy, financial concerns associated with medication costs and long-term monitoring, adherence, and potential for drug resistance with treatment interruptions; and (iii) patient and provider preferences.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Available treatments for hepatitis B e antigen (HBeAg)-negative chronic hepatitis B are associated with poor sustained responses. As a result, nucleoside and nucleotide analogues are typically continued indefinitely, a strategy associated with the risk of resistance and unknown long-term safety implications.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Current therapies are not curative
“Current therapies (pegylated interferon alfa [pegIFNa] and nucleos(t)ide analogues [NAs]) are not curative due to persistence of covalently closed circular DNA (cccDNA), a stable, non-integrated form of viral DNA located in the hepatocyte nucleus, as well as HBV DNA that is directly integrated into the host genome.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Low HBsAg loss on nucleos(t)ide analogues: pivotal and long-term trial data
| Regimen and duration | HBeAg-positive | HBeAg-negative |
|---|---|---|
| Entecavir, 48 weeks | “HBsAg loss: 2%” | “HBsAg loss: <1%” |
| Tenofovir disoproxil fumarate, 96 weeks | “HBsAg loss: 1%” | “HBsAg loss:0%” |
| Tenofovir alafenamide, 96 weeks | “HBsAg loss: 1%” | “HBsAg loss:<1%” |
| Tenofovir alafenamide, 5 years | “HBsAg loss: 0.8%” | “HBsAg loss:1.2%” |
Residual hepatocellular carcinoma risk during long-term nucleos(t)ide analogue therapy
“Of 1,644 patients, 903 were followed beyond year 10 (mean:14 ± 2 years). The 10- and 15-year cumulative incidences of HCC were 10.9% and 13.2%, respectively. The HCC IR was 1.25 before year 10 and 0.55/100 PYs after year 10 (p <0.001), with similar findings after inverse probability weighting.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Despite >10 years of NA therapy, patients with CHB remain at risk of HCC, although the incidence rate declines significantly. HCC remains the main determinant of mortality.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Persistence and adherence with long-term nucleos(t)ide analogue therapy: U.S. claims data
“In total, 6696 patients met the study eligibility criteria.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Overall, 40.6% of patients discontinued treatment; discontinuation probability was 29.4% at 12 months and 55.6% at 5 years. Of those who discontinued, 45.7% restarted during the study period. Mean adherence (proportion of days covered [PDC]) was 0.91, and 86.5% of participants had a PDC ≥ 80%.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“An inception cohort of 564 patients (24%), without a NA prescription in the 6 months pre-index period and at least 2 years of follow-up, was created. Persistence among the inception cohort was 29% for first year and 14% for first 2 years.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Peginterferon tolerability and response variability
Relapse risk with finite nucleos(t)ide analogue therapy
Place in treatment, anticipated use, and care setting
Summary: anticipated place in therapy
The label indicates bepirovirsen “in combination with nucleos(t)ide analog reverse transcriptase inhibitor (NrtI) therapy” for adults without cirrhosis who have received NrtI therapy for at least 6 months, have suppressed HBV DNA, and have HBsAg levels of 3,000 IU/mL or less by an FDA-authorized test, with a maximum treatment duration of 24 weeks. Its anticipated position is therefore among virologically suppressed adults already receiving entecavir, tenofovir disoproxil fumarate, or tenofovir alafenamide, the three nucleos(t)ide analogues the AASLD/IDSA guideline lists as preferred. The AASLD/IDSA and EASL 2025 guidelines both identify HBsAg loss (functional cure) as the desired treatment endpoint, and the AASLD/IDSA guideline states that updated guidelines can be anticipated “as new therapies are FDA-approved”. The label requires the initial dose to be given under healthcare provider supervision, permits patient or caregiver self-administration thereafter, and requires laboratory monitoring before, during, and after treatment; analysts quoted by Fierce Pharma stated that the monitoring burden “could slow adoption outside specialist hepatology centers.” In the pivotal trials, the functional cure rate was 19% (233 of 1,220) overall and 26% (200 of 768) in participants with baseline HBsAg of 1,000 IU/mL or less, a group GSK states represents “approximately 45% of diagnosed CHB cases globally”.
Labeled population
Regulator description of the approved population and companion diagnostic
Care setting and administration requirements in the label
Manufacturer statements on intended population, testing, and administration
Launch timing and anticipated uptake by care setting
Functional cure as a treatment goal: AASLD/IDSA 2025 guideline
Functional cure as a treatment goal: EASL 2025 guideline
Target population and role of nucleos(t)ide analogues in finite-therapy trials: 2022 AASLD-EASL endpoints conference
“Clinical trials should initially focus on patients with HBeAg-positive or negative chronic hepatitis B, who are treatment-naïve or virally suppressed on nucleos(t)ide analogues.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“As the only approved class of oral antiviral for CHB and the standard-of-care therapy for a majority of patients, NAs will have an important role to play in combination with novel agents in development because of their potency in inhibiting the production of new HBV DNA containing virions, and their well-characterized long-term safety profiles.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Heterogeneity of treatment effect
Bepirovirsen: response by baseline HBsAg level in the pivotal trials
| Baseline HBsAg subgroup | B-Well 1, HIBSAGO n/N (%) | B-Well 1, placebo n/N (%) | B-Well 2, HIBSAGO n/N (%) | B-Well 2, placebo n/N (%) |
|---|---|---|---|---|
| ≤3,000 IU/mL (primary endpoint) | “127/650 (20)” | “0/328 (0)” | “106/570 (19)” | “0/286 (0)” |
| ≤1,000 IU/mL (key secondary endpoint) | “105/426 (25)” | “0/214 (0)” | “95/342 (28)” | “0/179 (0)” |
Bepirovirsen: subgroups with lower response, genotype, and early on-treatment predictor
Bepirovirsen: on-treatment ALT flares accompanying HBsAg decline
Bepirovirsen: baseline HBsAg threshold derived from the phase 2b trial
Nucleos(t)ide analogues and natural history: HBeAg status and baseline levels
“A higher proportion of patients who tested negative for HBeAg at baseline had seroclearance (1.33%; 95% CI, 0.76-2.05) than those who tested positive for HBeAg (0.40%; 95% CI, 0.25-0.59) (P < .01).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Having HBsAg seroclearance was also associated with a lower baseline HBV DNA level (6.61 log10 IU/mL; 95% CI, 5.94-7.27) vs not having HBsAg seroclearance (7.71 log10 IU/mL; 95% CI, 7.41-8.02) (P < .01) and with a lower level of HBsAg at baseline (2.74 log10 IU/mL; 95% CI, 1.88-3.60) vs not having HBsAg seroclearance (3.90 log10 IU/mL, 95% CI, 3.73-4.06) (P < .01).” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Peginterferon: genotype and baseline predictors in guidelines
“HBV genotype: A and B genotypes are more likely to achieve HBeAg and HBsAg loss with peg-IFN than non-A or non-B genotypes.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“HBV genotyping can be useful in patients being considered for peg-IFN therapy, as genotypes A and B are associated with higher rates of HBeAg and/or HBsAg loss than genotype C and D, but it is not otherwise recommended for routine testing or follow-up of patients with CHB.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Peginterferon add-on: baseline HBsAg as the main predictor
“In a multivariable logistic regression model, adjusting for HBeAg status and viral load at start of therapy, lower SOT HBsAg was the main predictor for HBsAg loss (adjusted odds ratio (aOR) 0.28; 95% CI 0.20 to 0.39, p<0.001; table 2). HBeAg status was not associated with HBsAg loss after adjusting for SOT HBsAg (aOR 1.19; 95% CI 0.51 to 2.76, p=0.68). In univariable analyses, ethnicity, age or ALT at baseline were not associated with HBsAg loss (p>0.05).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Nucleos(t)ide analogue withdrawal: end-of-treatment HBsAg level and ethnicity
Peginterferon: HBsAg seroconversion by ethnicity in the HBeAg-positive pivotal trial
Care management intervention strategies
Linkage to care and treatment in the United States
“In a 2008–2016 study of adults with chronic HBV infection and commercial insurance, 36% (6,004 of 16,644) of patients were linked to care (defined as having had an ALT test and HBV DNA or HBeAg test) (51). Of the patients with chronic HBV infection with prescription claims, 18% (2,926 of 16,572) were treated.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Persons who receive a diagnosis of chronic HBV infection can benefit from monitoring and counseling, including mental health support (111).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“About half of the cohort (n = 6,559, 52.3%) did not have a complete laboratory evaluation (defined as having HBeAg, HBV DNA, and ALT tests) and only 72.4% (n = 9,129) had an "adequate" evaluation (at least HBV DNA and ALT) during the entire study period. Of those with an adequate evaluation, 11.2% were treatment eligible by AASLD criteria and 13.9% by EASL criteria; 60.4% of AASLD eligible patients and 54.3% of EASL eligible patients received treatment within 12 months from becoming eligible.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
“Patients who visited a specialist had a higher chance of receiving adequate evaluation and treatment.” (opens the original PubMed page at this quote in a new tab)View highlighted excerpt for this quote
Disparities in evaluation and treatment initiation
Hepatocellular carcinoma surveillance recommendations: AASLD/IDSA 2025 guideline
Hepatocellular carcinoma surveillance recommendations: EASL 2025 guideline
Use of hepatocellular carcinoma surveillance in practice: U.S. claims data
“Of 6831 patients (1122 on antiviral treatment, 5709 untreated), only 39.3% and 51.3% had received any abdominal imaging after 6 and 12 months, respectively, and patients were up to date with HCC surveillance guidelines for only 28% of the follow‐up time.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Monitoring during nucleos(t)ide analogue therapy
Monitoring after nucleos(t)ide analogue cessation following bepirovirsen
Screening and vaccination of contacts
“All patients who test positive for active HBV infection should be provided information on how to prevent transmission to others (Box 5). Notification, testing, and vaccination of their household contacts or former household contacts, sex partners, and needle-sharing contacts are recommended, as appropriate.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“In a study of programs testing and linking patients with hepatitis B to care in the United States, 14% of household contacts of persons who were HBsAg positive were themselves HBsAg positive, and 30% had a history of infection (anti-HBc positive) (55).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Other product development or post-marketing obligations required by the FDA
Postmarketing requirements and commitments in an FDA approval letter
No evidence found.
Populations without established safety and efficacy at approval
Ongoing pharmacokinetic study in moderate and severe renal impairment
European Union paediatric investigation plan: agreed measures
| Area | Measure |
|---|---|
| Clinical studies, Study 1 (206839) | “Open label, randomised, controlled study of pharmacokinetics (PK), safety and efficacy of bepirovirsen in children from 2 years to less than 18 years of age with chronic hepatitis B virus (HBV) infection.” |
| Extrapolation, modelling and simulation studies, Study 2 | “Population PK modelling and Exposure-Response study to determine paediatric doses of bepirovirsen for children from 2 years to less than 18 years of age.” |
| Extrapolation, modelling and simulation studies, Study 3 | “PK bridging/extrapolation of efficacy data to support the use of bepirovirsen for the treatment of chronic hepatitis B in children from 2 years to less than 18 years of age.” |
European Union paediatric investigation plan: waiver, completion date, and deferral
Further development: sequential daplusiran/tomligisiran followed by bepirovirsen
Ongoing post-approval monitoring
Laboratory monitoring after bepirovirsen discontinuation
Monitoring after nucleos(t)ide analog discontinuation
Monitoring statements in the Medication Guide
Companion diagnostic for monitoring during treatment
Durability of response off all treatment through week 96 in B-Well 1 and B-Well 2
Long-term follow-up study of durability: B-Sure
Risk evaluation and mitigation strategy
No evidence found.
Pregnancy exposure registry
No evidence found.
Expected outcomes of therapy
Treatment endpoints: functional and partial cure definitions
“The recommended endpoint of novel therapy is functional cure defined as HBsAg loss using a conventional assay for detection of HBsAg (limit of detection 0.05 IU/mL) and HBV DNA below the lower limit of quantification (i.e. < 10 IU/ml) at 24 weeks off-therapy.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“An intermediate endpoint on the pathway to functional cure is partial cure, defined as HBsAg <100 IU/ml and HBV DNA below the lower limit of quantification (i.e. < 10 IU/ml) at 24 weeks off- treatment. However, further clinical data are needed to establish that HBsAg decline to <100 IU/ml is a clinically meaningful threshold suitable for use as part of composite clinical trial endpoint.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“The panel continues supporting the recommendation that anti-HBs is not required for definition of functional cure, as HBsAg loss is maintained in over 90% of patients with or without anti-HBs in long-term follow-up with currently approved therapies but will need to be confirmed with therapies in development.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Expected characteristics of functional and partial cure: 2022 definitions
| Characteristic | Functional cure (2022 definition) | Partial cure (2022 definition) |
|---|---|---|
| HBsAg levels, IU/ml | “<LLOQ”View highlighted excerpt for this quote | “<100”View highlighted excerpt for this quote |
| HBV DNA levels, IU/ml | “<LLOQ”View highlighted excerpt for this quote | “< LLOQ”View highlighted excerpt for this quote |
| Clinical outcomes | “Improved”View highlighted excerpt for this quote | “Improved”View highlighted excerpt for this quote |
| Residual risk of HCC | “Very low”View highlighted excerpt for this quote | “Very low”View highlighted excerpt for this quote |
| Durability over time | “Yes”View highlighted excerpt for this quote | “Yes”View highlighted excerpt for this quote |
| Stigma for HBV | “No”View highlighted excerpt for this quote | “Yes”View highlighted excerpt for this quote |
Treatment goals beyond liver outcomes: AASLD/IDSA 2025 guideline
Clinical outcomes after HBsAg loss: EASL 2025 evidence review
Durability of HBsAg loss and hepatocellular carcinoma incidence: meta-analysis
“Thirty‐eight studies and 43,924 patients were finally included. The results showed that HBsAg seroclearance was durable, with a pooled recurrence rate of 6.19% (95% CI: 4.10%–8.68%).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
“Anti‐HBs seroconversion resulted in a significantly reduced recurrence rate (RR = 0.25, p < .001). Patients who experienced HBsAg seroclearance had significantly lower HCC incidence than HBsAg‐positive (RR = 0.41, p < .001). The pooled HCC incidence after HBsAg seroclearance was 1.88%; this rate was reduced to 0.76% among patients without baseline cirrhosis.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
HBsAg loss and clinical outcomes in a U.S. cohort
“In total, 15,760 patients with chronic HBV infection were included; 5.6% were receiving stable antiviral treatment. Overall, 4.2% (n = 667) experienced HBsAg loss across the study period. HBsAg loss was associated with an 89% and 62% reduced risk of hepatocellular carcinoma (HCC; adjusted hazard ratio [aHR]: 0.11, 95% CI: 0.01–0.76) and all‐cause mortality (ACM; aHR: 0.38, 95% CI: 0.20–0.74), respectively. Risks of compensated cirrhosis (aHR: 0.84, 95% CI: 0.52–1.35) and decompensated liver disease (aHR: 0.74, 95% CI: 0.37–1.48) were lower after HBsAg loss, but did not reach significance.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote
Residual hepatocellular carcinoma risk after HBsAg loss
“Although progression of liver disease to cirrhosis or hepatic decompensation generally stops when patients lose HBsAg unless other causes of liver injury are present (eg, heavy alcohol consumption or nonalcoholic fatty liver), the risk of HCC persists, particularly if HBsAg loss occurred in patients older than 50 years or in those with cirrhosis or coinfection with HCV or hepatitis D virus (HDV) (128, 130–132).” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quote