Mechanism of action

“HIBSAGO (bepirovirsen) injection is a hepatitis B virus (HBV) messenger RNA-directed antisense oligonucleotide.” (opens the prescribing information at this quote)CopyFlag

“HIBSAGO is an antiviral drug against HBV [see Microbiology (12.4)].” (opens the prescribing information at this quote)CopyFlag

“Bepirovirsen is a synthetic, single-stranded, chimeric antisense oligonucleotide (ASO) with a gapmer architecture consisting of five 2′-O-(2-methoxyethyl) (2′-MOE)-modified ribonucleotide wings flanking a central 10-deoxynucleotide gap with phosphorothioate linkages throughout.” (opens the prescribing information at this quote)CopyFlag

“Bepirovirsen is designed to bind a conserved 20-nucleotide site” (opens the prescribing information at this quote)CopyFlag

“present in HBV mRNAs (including the pregenomic RNA [pgRNA], precore, preS1, preS2/S, and X mRNAs), forming a DNA:RNA heteroduplex that recruits endogenous ribonuclease H1 (RNase H1) to catalyze irreversible hydrolysis of the viral RNA strand at the 3’-O-P bonds, resulting in degradation of HBV mRNA and reduction in HBV DNA and viral proteins, including HBsAg.” (opens the prescribing information at this quote)CopyFlag

“The 20-nucleotide binding site is present within transcripts derived from both cccDNA and integrated HBV DNA.” (opens the prescribing information at this quote)CopyFlag

“Bepirovirsen (previously ISIS 505358; GSK3228836) is an antisense oligonucleotide (ASO) with a 2′-O-methoxyethyl (2′-MOE) gapmer design (full sequence is publicly available)13.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“The bepirovirsen binding site (GCACTTCGCTTCACCTCTGC) is present in all HBV mRNA and pregenomic RNA; as such, bepirovirsen would be expected to reduce levels of all HBV mRNAs including pregenomic RNA.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“Specific ASOs bind to complementary HBV RNA transcripts forming a hybrid ASO/RNA complex, which recruits endogenous RNase H, cleaving the HBV RNA and leading to degradation of the transcript.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“The substantial reduction of HBsAg in HBeAg-negative patients suggests that the bepirovirsen target site is preserved in the majority of transcripts derived from integrated HBV genomes.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“Conservation of the bepirovirsen target site across HBV genotypes indicates broad antiviral activity.” (opens the prescribing information at this quote)CopyFlag

“Bioinformatic analysis of 9,139 HBV genomes in the HBV database showed that the target sequence is conserved across genotypes A-H and recombinant forms, with full identity to 97.6% of sequences, and to 99.7% of sequences when allowing for one nucleotide mismatch.” (opens the prescribing information at this quote)CopyFlag

“Bepirovirsen reduced the level of HBV RNA transcripts in a dose-dependent manner in HepG2.2.15 cells (HBV genotype D) using transfection-based delivery resulting in EC50 values of 70 nM (16 hours) and 122 nM (48 hours) as measured by two RT-qPCR primer/probe sets targeting pgRNA, preS1, and preS2/S mRNAs.” (opens the prescribing information at this quote)CopyFlag

“In HepG2.2.15 cells (HBV genotype D, transfection-based delivery), bepirovirsen reduced intracellular HBV DNA with EC50 values of approximately 171 nM and 53 nM by qPCR at 48 and 96 hours, respectively, and inhibited extracellular HBsAg and HBeAg secretion with EC50 values of approximately 138 nM and 296 nM by ELISA at 48 hours, respectively.” (opens the prescribing information at this quote)CopyFlag

“In primary human hepatocytes (HBV genotype D, free uptake), 4 doses of bepirovirsen every ~72 to 96 hours inhibited extracellular HBsAg and HBeAg secretion with EC50 values of 47.1±0.7 nM and 29.8±2.9 nM, respectively, as assessed by ELISA ~96 hours after the last dose.” (opens the prescribing information at this quote)CopyFlag

“Bepirovirsen inhibited extracellular HBsAg with an EC50 value of approximately 0.20–0.30 nM by chemiluminescent immunoassay (HBV genotype A; at ~96 hours) and reduced intracellular HBV DNA by approximately 3.5 to 5 log10 across genotypes A, B, C, and D by qPCR (at ~48 hours) at a fixed molar ratio.” (opens the prescribing information at this quote)CopyFlag

“Combining bepirovirsen with entecavir or tenofovir disoproxil fumarate in HepG2.2.15 cells (HBV genotype D, transfection-based delivery) resulted in no antagonism and greater reductions of intracellular HBV DNA by qPCR compared to the individual drugs.” (opens the prescribing information at this quote)CopyFlag

“Bepirovirsen is unconjugated,6 in contrast to small-interfering RNAs currently in development, which are conjugated to a N-acetylgalactosamine (GalNAc) for targeted delivery to hepatocytes.7 This unconjugated design may facilitate delivery to and uptake by a broader range of cells within the liver, including non-parenchymal cells, such as liver-resident macrophages (Kupffer cells) and endothelial cells.8” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“Notably, bepirovirsen demonstrated superior efficacy to GSK3389404, its GalNAc-conjugate, in phase II clinical trials, suggesting a possible advantage in engaging a broader array of liver cells.4,10” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“Clinical and preclinical data demonstrate that bepirovirsen elicits an innate immune response, evidenced by induction of inflammatory cytokines. This effect is mediated at least in part by TLR8 activation, complementing its established antiviral mechanism.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“This study demonstrates that bepirovirsen can induce an innate immune response, likely through TLR8 agonism, in addition to its known antiviral mechanism; however, the clinical impact of this immunomodulatory effect remains unclear and requires further investigation.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“Bepirovirsen binds to a complementary sequence present in all HBV messenger RNA transcripts and targets all HBV RNAs (including pregenomic RNA), impacting HBV infection in 3 ways: reductions in viral proteins, including HBsAg; reductions in HBV DNA; and stimulation of the immune system, potentially via Toll‐like receptor 8 activation.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag

“These findings provide evidence that bepirovirsen may modulate the immune system to facilitate infected hepatocyte killing in chronic HBV infection in addition to its direct antiviral effects; therefore, ALT increases could reflect a therapeutic response to bepirovirsen.” (opens the original PMC page at this quote in a new tab)View highlighted excerpt for this quoteCopyFlag